Summary Sequence Context  
1 homologue found:

HomologuedndD
OrganismMycobacterium abscessus ATCC 19977
GID1101
PID2101
Locus tagMAB_1096
Locations1108474..1110450
Length1977 bp
G+C%61.9
Link NCBI: gi:169627108   
SequenceATGATTCTCGATAACTTGGTGTTGGAGAACATCGGCACCTTCGGCGGCAAGAACGAAATCCGTCTCACGC
CATCCTCGTCTAAGAAGCCGGTGGTGCTGATTGGCGGCCTGAACGGTGCTGGCAAGACGACAATTCTCGA
AGCTATCCACCTCGCGCTGTACGGGCCGTTGTCACAAGCCCGAAGTCGACGCAGCGGCAGCTACGACACG
TACTTGCGAAGCCTGATACACCACGGCGTGCCAGCCTCGGAGGGCGCAGCAGTTGAGCTGAGCTTTCACC
TCTTCCAACAAGGGGAGGAGCACTCGTACCGGATTAGGCGACGATGGCAAGGCGGCGGTGCGTCGCTACA
AGAGTTTGTGCTCGTGTGGGTCGACGGCAAGTATGACGATGCGTTGACATCCACATGGAACGAACATGTG
GAAACGTTCATCCCGCGCGGGATCGCGGGACTGTTCTTCTTCGATGGCGAGCAGATCGAAGCCCTCGCTG
ATTTGGAGCAATCCCAACATGTACTCAAGTCAGCGCTCGCCGCTCTCCTTGGCCTCGATCTGATCGACCG
TCTATCTACAGATCTCGCCGTGTTGCGGCGGCGCCACCGCGGCGCTGAGGTTCCCGATGACTTGCGGCTG
GCTGTTGAAGAGCGGCGCAAAACCGTCACGTTGGCTCGTCAGGGTGAGGAGATGGCCGCGACGTTGGCAG
CGACGTCGCGGGTGGAGGCAGAACGGGCGGACAAGCGCCTTAACGAAGTCACTGAGCAGTACCGGGCGGC
CGGAGGCGGTCTGCTTGAACAACGAGACGCCGCGAACACGCGGGTGACTTTAGTGCGACAACAGATCGCT
GACCTTGACGATGAGCTTCGCGCGGAAGCGGCTGATACCGCTCCCTTCCTCCTGGTCGGAGGCCTGCTGG
GTGATCTGGCCAATCATGTGGCACGCGAGCGGGACGCGCGCCGCGATTCGCTGGTGCTGAGCGTCGTGGG
CGACCGCGATCGCGAGCTATTGGGACTGCTGCGCAAGGCAAAGGTTCGGGGAGCGGCGCTCACCGCGCTG
GAAGAGTTCATGGCTTCGGATGTCGCGTCTCGCCAGGATGCATCGGCGCGCGTCCCGATGGTGAGCGGGC
TACGCGATGGGGGACCTGTCGAGGCCCTACACGCAAGCGTCCTACCGTCGACACAGAATCGTGTAGCGAG
CCTGGTGGAACGGCGGGTCGCGCTCGCCGAAGAACTGGTGCAGGCCGAGCGAACGCTGGTTGCCATTCCA
GATCCGGAATCGCTCGCATCACTCAAGCAGGAACTTGATGAGGCGTCCGAAGCCGCTGTGAGGTGTCACG
CGCTTCTCGTCCAGAACGAGGATCAGCTCGAAGCATCGCGCCAGGAGCGCGCTCGTGCCGACAGCGCATA
CGAAGCCGCGATGGACAAGTCGGCACAGGCAACACTCGACGCCGACGATGATCGCCGCCTGGTTGAGCAC
GCCGAGCGGGCTCGTGTGACCCTGGATGAGCTGAAGACCAAGGCTGCCGAGCGGCACGTCAGCCAGATTG
GTCGCCTGGTACTCGAAGCACTCACCAGGCTTCTCCGCAAAGACCGCCTCGTCACCGACGTTCGCATTGA
CCCGACGTCATACACCGTTGAGTTGGTCGGTTCTGATGGTCAGAGTCTCGCGGCAACGGAGCTGTCTGCC
GGCGAGCGGCAGCTCTTGGCGGTGGCACTTCTGTGGGGACTTGCCCAGGCGGCCGGCCAACCGCTGCCGA
TGGTCATTGACACACCACTCGGCCGGCTAGACGGTGCGCATCGAGGTCGGCTCATCGAACGGTACTTTCC
GCATGCGGCTCATCAGGTCGTGTTGCTGTCGACCGACACTGAAGTCGACGAAGCGGCATTGAAATCGTTG
CGGCCGTCCGTCGGGAGGATGTACCGGCTGGAGTTCGATAGCGCTGTTAACGCCACGACGGTTCAACTCG
GATATTTTTGGGAGTGA