Summary Sequence Context  
1 homologue found:

HomologuedndE
OrganismMycobacterium abscessus ATCC 19977
GID1102
PID2102
Locus tagMAB_1097
Locations1110453..1110845
Length393 bp
G+C%59.7
Link NCBI: gi:169627108   
SequenceATGAGCATCGAGCACATCCGGTTGACGACAACGGCTCGCGACCAGCTAGTCACTCTGAAACGTCGAACCG
GCATCACACAGTGGAATGTCCTGTGCCGCTGGGCGCTCTGCCGTTCTTTGGGGGAGTCTGCACCGCCTCC
TGTGGCGAAGCTGGTGTTCGACAGCAATGTGGAGATGACATGGCGGGTGTTCGCCGGGGAACACGGCGAC
GAGTTGCTCGCGCTGGTGCGCTATCGCTGTCACGTCGACGGATTAGCCACGGATGACGACACGATTGGGC
AGCAGCTCCGTCTCCATCTTCATCGCGGGATTGGCTATCTGGTTGGTGATCCGCGTGTCACTAACATTGC
GGGACTTGCCTCTCTTGTACTGGAACAGCCGCCAGCGGCATGA