Summary Sequence Alignment 16S rRNA Context  
4 homologues found:

HomologuedndB
OrganismClostridium perfringens NCTC 8239
GID1103
PID2103
Locus tagAC7_1516
Locations73691..74791
Length1101 bp
G+C%28.1
Link NCBI: gi:153883869   
SequenceATGGATAATAATTTCTTTTATAAATTTCCAGCACTTAAAGGAATTCAGGCATCTAGAGAGTTTTTCGTAA
TTATGTGTCCTTTATCTGTATTATCAAAGTTATTTATTTTTAATGATGATGAGCTACCTCCAGAATATCG
TGCACAAAGATTATTAAATAAATCTAGAATACCCGAAATAACATCCTATATGGTGGATAATCCTAATGAC
TATGTATTTTCATCTGTTACAGCATCAATTGATGGTGAATTTTCATTTGAACCCTTTGAAAAAGCTTCAA
ATGAAAACATGGGAACTTTGCAAGTGTCTATGGATAGCAGACTATTAATAAATGATGGTCAACATAGAAG
AGCAGCTATTGAGGAAGCTTTAAAAGTTTCACCTGAATTAGGTAAAGAAACTATCTCAGTAGTTTTATTT
ATAGATGAAGGACTTAATAGAAGCCAACAAATATTTGCTGATTTAAACAAACATGCTGTTAATGTTTCAA
AGTCAATAGGTATTTTATACGATTCTAGAGATCCTATTGCCCTAACTACTAAAGCCCTTATTGAAAAAAA
TAAGTTTCTTAAATACTTCACAGATAGAGAACAACCCTCTTTGTCTAAGTATTCAAATAAACTATTTACA
TTAAGTAGTATAAATGAAACAAATAAAAAGTTACTTTGTAAACTTGACCCTAAGGATGAATCTACTCAAA
AATTTGTATATGAATTTTGGAATTGCTTATGTACAAATATGAAAGAATGGCAGTTTGTTTTTAATAAAGA
AATTAGCCCTAGTATCTTTAGAAAATCTTATATTAGTTCTAATGCTGTAATACTTGAATCTTTAGGTATT
ATAGGAAATTGTCTTTTTAGAAAAAACAAATCTAATTGGAAAGAATATATGATTAAACTAAATGAAATTA
ATTGGAATAGATCTAATCTAGAAGATTGGGGTAATCGTGCTATTGGAAATAACGGACGTATAGTAAAAAA
CTCTAATTACATAAAGCTTACAACAAACTTTATAAAACTACAGCTTGGAATTAAGCTTAATCATGATGAA
TTAGAGTTGGAAAATTCATATAGAAAGCAGAAGGAAAATAAAAATGAGTAG

HomologuedndC
OrganismClostridium perfringens NCTC 8239
GID1104
PID2104
Locus tagAC7_1517
Locations72073..73698
Length1626 bp
G+C%27.7
Link NCBI: gi:153883869   
SequenceATGAGTAGTTTAAATATAAATGACAAAATTAATAATATACTAGATGAAATGACTCGTGTATATAAAAATG
ATTCAAGACCTTGGGTTATAGGATATAGTGGTGGAAAAGATAGTACTACTGTTGTTTTATTAGCATTTAA
AATGCTTCAAAACTTACCAAAGGAAGAAAGACATAAACCAGTTTATGTAATTTCATCAGATACCTTAATT
GAAAATCCTATAGTATTATCTTATTTACAACAAAACTCAAAATACATAAATGAAGGTGCTAAAAATCTAG
GATTACCTTTATATACTGATATGATACACCCAGATTATAATAATACATTTTGGGCTAATGTAATTGGTAA
GGGCCTTCCAACCCCTACTTCTATTAGATTTAGATGGTGTACTGAAAGATTAAAAATTAAACCTTCTAAT
AAGTTTATTGAAGATAAAGTTAAAGAAAATGGCGAAGTTGTTGTATTACTTGGTGTTAGAAAATCTGAAA
GTATAGCAAGAGGAATTAGAATAAAAAATAGAGAAATTGAAGGTTATTTATTAACACCTCATGTAACTCT
ACAAAACACTTATGTTTATAATCCTATTGTTGAACTTTCAACAGATGATGTTTGGGCTATTCTACTTTCA
AATAATGGTGAAACTCCATGGGGAACTAATAATAATGATTTATTTGCCCTTTATATGGGTGGTGAAGGCG
GAGAATGTCCTTTTACTGTAACAAACGATTCAGAGACACCTTCTTGTGGAAATTCCAGATTTGGTTGTTG
GATCTGTACCGTTGTTAAAGAAGATAAATCATTAACTGGGTTTATAGAAAGCGGAGAAACTGAACTTCAA
CCACTACTTGATTTTAGAAGTTGGCTATTAAGCATACGTGATAAACATGAATATAGACAGAAGTATAGAA
GAGATGGAAATCATTATTATAAAAAACTTTACTTAGAGAAAATGCCTTTACTAAATGATTATATTATTGA
TAAAAACCATCTATTCTTTGATAAAGAAAATAATGAAGGATATATAGATTTAGTTAGATCTAAGGAAACT
GATGAGCTTTTAAATAAAAAGTCAACAGATAAAGACAAAATATTCCTAGAACTAATTCCAACAGTTGAAT
CTGGTGAAGATATTAAATTAGACCTTAGTAAAATTCACTCTGATTCAAAAGGTGAATTCATAAATGTTGT
TGGTTATGGACCATTTAATTTTAAGGCTAGAAAACTTATTCTTGAAAAATTACTTGAAACTCAAAATAAA
ATTCAAGAATCCTATGACCTTGATTTAATAACAATTCAAGAGTTAGAAGCCATAGATAAAATCTGGGATG
ACGAGGAAGATTTAACTCGTAGAAGCTTAGTTGAAATTTATTATAACAAAACTGGTAATAGACTTCCTTG
GGATGATTATAAAAAACCTATTTTTGATAATTCTACATTAGAAACAATATCTAATTTATGTGTAGAAACA
GATATTCCAGAAGATTTAATCAATAAATTACTTATAGAAAGCAATAAATATAAACATTTTACAAATAAAA
CTATACTAGATAAATCTATAAGCAAATTATTAAATCAAAAACATTTACACAAAAGTTTAGTTGAGGAGAT
AGACAATGATAATTAA

HomologuedndD
OrganismClostridium perfringens NCTC 8239
GID1105
PID2105
Locus tagAC7_1518
Locations69927..72083
Length2157 bp
G+C%22.6
Link NCBI: gi:153883869  
SequenceATGATAATTAATAATATAACACTTAAAAACTTTAGATCATATGAAGATGAAACTACCTTCTCATTTACTC
CAAATGGCAATAAAAATATAGTTTTAATTGGTGGTGAAAATGGAGCTGGTAAATCTACTCTATTTGAAGC
AATTAAGCTTTGTATATACGGTCCAACGACTTATGGATATCTTGGTAATAACTATAATTATCAAACTAAA
ATAAAAAATAATATTAATGATAATGCTTTTAAAAATGAAGATATAGAATCATTTATAGGTTTAAGCCTTT
CATTTAAAGAAGGAACAGAATTAAAAGATTATTATCTTAAACGTATATGGAAATATAAAAAGCATAAATT
AAATGAAGAATTTAAAGTATTTTTAAATGATAAAGAACTTTCTGAAGATGATAAACTTTATTTTGATAAG
TATTTAAAATCAGTATTACCTCCTTCACTATTCGACTTTTTCTTTTTCGATGGTGAAGAATTAAGCGATT
TCTTTGTTGGTAAATCATCAAGTTCAAACTTAAAAGAAGCTGTACTTGAACTTTTCAACTATGATACATT
TGATGTATTAAAAAAACAATTACTTTCTTATCAAAGAACACATTCTAAAGAAAATAAAAATTTAGATGAA
GCTCAAGCTAGATATGATGAACTTTCATCTGAAATACATGAAATTAAAAATAATATATCAGAACTTAAAA
ATATAATTTTTAATAATGAATCTATCCTTGATGATCTTTATATAAAGAAACAAAATGCCGAAGATGATTT
TAGAAATAGTGGTGGTATTTTTGAAGAAGAAAGATTGTTGTTAAATTCACAGATTAATAAGCTTGAATCT
GAACGTACAGAAATAAATCAAGAAATTAAAGATTTTTGTAATGATACTCTTCCATTTTTAATAGTATCTA
AGCTATTAAAAAATACTAAAAAACAAATTGATGAAGAAGAAGCACTTATTTCATTTAATAGTATAAGTAA
AAAGTTATCTGGTAATATTATAAAATCAACACTAAACAAACATTTACCTAAACATAATAATGTTAATTAT
GATGAAATAGCCTTAACTCTTTTAAATGAGATGTTTGAATTAGATAAAATGAATAATATTTCTAATATAT
TGGAACTTTCAAATGAAGATAAAAATTCAATCAATTTCATAATTAATAACATATTAAGTAAAAGTAATGA
TTTTAAGTTTGATATATTATCAAAATTCACTAGACTTAAAGAAATTTCATTAAGTATTAAGATTTTAAGA
GAAAAACTTAATTCAACAGTTTCTGGTGATTTCTTAAATAACTATTTAGAAACAACTGCTATTTTAAACA
AACAAATAAGTGATACTGAAAATATAATTACTTCTTCAAAAGCTAAACTTGAAGAAAAATATAAGCAATT
ATCTTTAAAAGAGTATCATTTAACAAGAGCTAAAAATGAACTTACATCATTACTACAAAATAATAATGTT
TTAGAAATGTCATCTAGCATAATTAGCTATTTAGATAAACTTCTAAAAAATATTACTAGAGATAAAATTG
ATGCTATAGAAGAAGAATTTATTAACATATTTAAAAATATTATAAGAAAAGACAACTATGTAAATAGCAT
TGTAATTGATGATTCATTTAATTCTACTCTTTACATAAATAAAGAGTATGATACAAATGAAATATTAAAT
ATATTAACTAATCTTGGTTTTGAAGGAACTGAAAAGAAATATGGTTCTAAGTTCATAGATGATTTATTTA
AATATTTTAATGTACTTGATTATAAGAATTTAACTAAAAAACTTGAACAAATAGCCTTAGTTGAATATAT
TTCTTTAAGTTCAAAAGTTAATATAAATGACTTCTCAAAAGGAGAAAAACAAATTTATATACTTTGTTTA
ATTTGGGCTATTATAAAGAGTTCTGGTGTTGAAATACCATTTATAATTGATACACCGTATGCTCGTATAG
ATGAAACGCATAGAAATGCTTTAACAACAACTTACTTGCCTAATATAAGTAAGCAGGTTATTATACTTTC
AACTAATAAAGAAATTGATAGTGACTTATATCAAGTTGTTAAGCCTTATGTATGTAATGAATATCTACTT
CTTTACAATACAAATTTAAGAAAAACAGAAGTTAAAAATGGATATTTTGAGGTGTAA

HomologuedndE
OrganismClostridium perfringens NCTC 8239
GID1106
PID2106
Locus tagAC7_1519
Locations69535..69924
Length390 bp
G+C%30.2
Link NCBI: gi:153883869  
SequenceATGGGATTTAGATTAAAAACGTCAAAAAAAACAAAAGAAATATTTGAAGAATTAGGTGGAAGTTCAAATC
TTAAGCCCTTTGCATTAAGTAAAATAGCCGTTTCTATGTCTCTAAATCATGAAACACCTATTGAAGAATA
TGAAAGTAAGGATACAAATGGACTTGAACTACAAAGAGCTACTGTTACTGGTGAATTTGATGCTATATTC
AAAGCTCTTATTGAAATGAACTTAGGAAGACATATTTCAGATGATGACTACTATCCTACTTATATGAAGC
TTCATATGGATAGAGGTGCTGAACTTCTTTATAATAAATATAAATACTCAGGGGGTAACTTAGAAAAATT
TATAACTAAGATACTTGATGAAGGAGATGCTAGTATATGA