Summary Sequence Context  
1 homologue found:

HomologuedndB
OrganismClostridium perfringens NCTC 8239
GID1103
PID2103
Locus tagAC7_1516
Locations73691..74791
Length1101 bp
G+C%28.1
Link NCBI: gi:153883869   
SequenceATGGATAATAATTTCTTTTATAAATTTCCAGCACTTAAAGGAATTCAGGCATCTAGAGAGTTTTTCGTAA
TTATGTGTCCTTTATCTGTATTATCAAAGTTATTTATTTTTAATGATGATGAGCTACCTCCAGAATATCG
TGCACAAAGATTATTAAATAAATCTAGAATACCCGAAATAACATCCTATATGGTGGATAATCCTAATGAC
TATGTATTTTCATCTGTTACAGCATCAATTGATGGTGAATTTTCATTTGAACCCTTTGAAAAAGCTTCAA
ATGAAAACATGGGAACTTTGCAAGTGTCTATGGATAGCAGACTATTAATAAATGATGGTCAACATAGAAG
AGCAGCTATTGAGGAAGCTTTAAAAGTTTCACCTGAATTAGGTAAAGAAACTATCTCAGTAGTTTTATTT
ATAGATGAAGGACTTAATAGAAGCCAACAAATATTTGCTGATTTAAACAAACATGCTGTTAATGTTTCAA
AGTCAATAGGTATTTTATACGATTCTAGAGATCCTATTGCCCTAACTACTAAAGCCCTTATTGAAAAAAA
TAAGTTTCTTAAATACTTCACAGATAGAGAACAACCCTCTTTGTCTAAGTATTCAAATAAACTATTTACA
TTAAGTAGTATAAATGAAACAAATAAAAAGTTACTTTGTAAACTTGACCCTAAGGATGAATCTACTCAAA
AATTTGTATATGAATTTTGGAATTGCTTATGTACAAATATGAAAGAATGGCAGTTTGTTTTTAATAAAGA
AATTAGCCCTAGTATCTTTAGAAAATCTTATATTAGTTCTAATGCTGTAATACTTGAATCTTTAGGTATT
ATAGGAAATTGTCTTTTTAGAAAAAACAAATCTAATTGGAAAGAATATATGATTAAACTAAATGAAATTA
ATTGGAATAGATCTAATCTAGAAGATTGGGGTAATCGTGCTATTGGAAATAACGGACGTATAGTAAAAAA
CTCTAATTACATAAAGCTTACAACAAACTTTATAAAACTACAGCTTGGAATTAAGCTTAATCATGATGAA
TTAGAGTTGGAAAATTCATATAGAAAGCAGAAGGAAAATAAAAATGAGTAG