Summary Sequence Context  
1 homologue found:

HomologuedndC
OrganismClostridium perfringens NCTC 8239
GID1104
PID2104
Locus tagAC7_1517
Locations72073..73698
Length1626 bp
G+C%27.7
Link NCBI: gi:153883869   
SequenceATGAGTAGTTTAAATATAAATGACAAAATTAATAATATACTAGATGAAATGACTCGTGTATATAAAAATG
ATTCAAGACCTTGGGTTATAGGATATAGTGGTGGAAAAGATAGTACTACTGTTGTTTTATTAGCATTTAA
AATGCTTCAAAACTTACCAAAGGAAGAAAGACATAAACCAGTTTATGTAATTTCATCAGATACCTTAATT
GAAAATCCTATAGTATTATCTTATTTACAACAAAACTCAAAATACATAAATGAAGGTGCTAAAAATCTAG
GATTACCTTTATATACTGATATGATACACCCAGATTATAATAATACATTTTGGGCTAATGTAATTGGTAA
GGGCCTTCCAACCCCTACTTCTATTAGATTTAGATGGTGTACTGAAAGATTAAAAATTAAACCTTCTAAT
AAGTTTATTGAAGATAAAGTTAAAGAAAATGGCGAAGTTGTTGTATTACTTGGTGTTAGAAAATCTGAAA
GTATAGCAAGAGGAATTAGAATAAAAAATAGAGAAATTGAAGGTTATTTATTAACACCTCATGTAACTCT
ACAAAACACTTATGTTTATAATCCTATTGTTGAACTTTCAACAGATGATGTTTGGGCTATTCTACTTTCA
AATAATGGTGAAACTCCATGGGGAACTAATAATAATGATTTATTTGCCCTTTATATGGGTGGTGAAGGCG
GAGAATGTCCTTTTACTGTAACAAACGATTCAGAGACACCTTCTTGTGGAAATTCCAGATTTGGTTGTTG
GATCTGTACCGTTGTTAAAGAAGATAAATCATTAACTGGGTTTATAGAAAGCGGAGAAACTGAACTTCAA
CCACTACTTGATTTTAGAAGTTGGCTATTAAGCATACGTGATAAACATGAATATAGACAGAAGTATAGAA
GAGATGGAAATCATTATTATAAAAAACTTTACTTAGAGAAAATGCCTTTACTAAATGATTATATTATTGA
TAAAAACCATCTATTCTTTGATAAAGAAAATAATGAAGGATATATAGATTTAGTTAGATCTAAGGAAACT
GATGAGCTTTTAAATAAAAAGTCAACAGATAAAGACAAAATATTCCTAGAACTAATTCCAACAGTTGAAT
CTGGTGAAGATATTAAATTAGACCTTAGTAAAATTCACTCTGATTCAAAAGGTGAATTCATAAATGTTGT
TGGTTATGGACCATTTAATTTTAAGGCTAGAAAACTTATTCTTGAAAAATTACTTGAAACTCAAAATAAA
ATTCAAGAATCCTATGACCTTGATTTAATAACAATTCAAGAGTTAGAAGCCATAGATAAAATCTGGGATG
ACGAGGAAGATTTAACTCGTAGAAGCTTAGTTGAAATTTATTATAACAAAACTGGTAATAGACTTCCTTG
GGATGATTATAAAAAACCTATTTTTGATAATTCTACATTAGAAACAATATCTAATTTATGTGTAGAAACA
GATATTCCAGAAGATTTAATCAATAAATTACTTATAGAAAGCAATAAATATAAACATTTTACAAATAAAA
CTATACTAGATAAATCTATAAGCAAATTATTAAATCAAAAACATTTACACAAAAGTTTAGTTGAGGAGAT
AGACAATGATAATTAA