Summary Sequence Context  
1 homologue found:

HomologuedndD
OrganismClostridium perfringens NCTC 8239
GID1105
PID2105
Locus tagAC7_1518
Locations69927..72083
Length2157 bp
G+C%22.6
Link NCBI: gi:153883869  
SequenceATGATAATTAATAATATAACACTTAAAAACTTTAGATCATATGAAGATGAAACTACCTTCTCATTTACTC
CAAATGGCAATAAAAATATAGTTTTAATTGGTGGTGAAAATGGAGCTGGTAAATCTACTCTATTTGAAGC
AATTAAGCTTTGTATATACGGTCCAACGACTTATGGATATCTTGGTAATAACTATAATTATCAAACTAAA
ATAAAAAATAATATTAATGATAATGCTTTTAAAAATGAAGATATAGAATCATTTATAGGTTTAAGCCTTT
CATTTAAAGAAGGAACAGAATTAAAAGATTATTATCTTAAACGTATATGGAAATATAAAAAGCATAAATT
AAATGAAGAATTTAAAGTATTTTTAAATGATAAAGAACTTTCTGAAGATGATAAACTTTATTTTGATAAG
TATTTAAAATCAGTATTACCTCCTTCACTATTCGACTTTTTCTTTTTCGATGGTGAAGAATTAAGCGATT
TCTTTGTTGGTAAATCATCAAGTTCAAACTTAAAAGAAGCTGTACTTGAACTTTTCAACTATGATACATT
TGATGTATTAAAAAAACAATTACTTTCTTATCAAAGAACACATTCTAAAGAAAATAAAAATTTAGATGAA
GCTCAAGCTAGATATGATGAACTTTCATCTGAAATACATGAAATTAAAAATAATATATCAGAACTTAAAA
ATATAATTTTTAATAATGAATCTATCCTTGATGATCTTTATATAAAGAAACAAAATGCCGAAGATGATTT
TAGAAATAGTGGTGGTATTTTTGAAGAAGAAAGATTGTTGTTAAATTCACAGATTAATAAGCTTGAATCT
GAACGTACAGAAATAAATCAAGAAATTAAAGATTTTTGTAATGATACTCTTCCATTTTTAATAGTATCTA
AGCTATTAAAAAATACTAAAAAACAAATTGATGAAGAAGAAGCACTTATTTCATTTAATAGTATAAGTAA
AAAGTTATCTGGTAATATTATAAAATCAACACTAAACAAACATTTACCTAAACATAATAATGTTAATTAT
GATGAAATAGCCTTAACTCTTTTAAATGAGATGTTTGAATTAGATAAAATGAATAATATTTCTAATATAT
TGGAACTTTCAAATGAAGATAAAAATTCAATCAATTTCATAATTAATAACATATTAAGTAAAAGTAATGA
TTTTAAGTTTGATATATTATCAAAATTCACTAGACTTAAAGAAATTTCATTAAGTATTAAGATTTTAAGA
GAAAAACTTAATTCAACAGTTTCTGGTGATTTCTTAAATAACTATTTAGAAACAACTGCTATTTTAAACA
AACAAATAAGTGATACTGAAAATATAATTACTTCTTCAAAAGCTAAACTTGAAGAAAAATATAAGCAATT
ATCTTTAAAAGAGTATCATTTAACAAGAGCTAAAAATGAACTTACATCATTACTACAAAATAATAATGTT
TTAGAAATGTCATCTAGCATAATTAGCTATTTAGATAAACTTCTAAAAAATATTACTAGAGATAAAATTG
ATGCTATAGAAGAAGAATTTATTAACATATTTAAAAATATTATAAGAAAAGACAACTATGTAAATAGCAT
TGTAATTGATGATTCATTTAATTCTACTCTTTACATAAATAAAGAGTATGATACAAATGAAATATTAAAT
ATATTAACTAATCTTGGTTTTGAAGGAACTGAAAAGAAATATGGTTCTAAGTTCATAGATGATTTATTTA
AATATTTTAATGTACTTGATTATAAGAATTTAACTAAAAAACTTGAACAAATAGCCTTAGTTGAATATAT
TTCTTTAAGTTCAAAAGTTAATATAAATGACTTCTCAAAAGGAGAAAAACAAATTTATATACTTTGTTTA
ATTTGGGCTATTATAAAGAGTTCTGGTGTTGAAATACCATTTATAATTGATACACCGTATGCTCGTATAG
ATGAAACGCATAGAAATGCTTTAACAACAACTTACTTGCCTAATATAAGTAAGCAGGTTATTATACTTTC
AACTAATAAAGAAATTGATAGTGACTTATATCAAGTTGTTAAGCCTTATGTATGTAATGAATATCTACTT
CTTTACAATACAAATTTAAGAAAAACAGAAGTTAAAAATGGATATTTTGAGGTGTAA