Summary Sequence Context  
1 homologue found:

HomologuedndE
OrganismClostridium perfringens NCTC 8239
GID1106
PID2106
Locus tagAC7_1519
Locations69535..69924
Length390 bp
G+C%30.2
Link NCBI: gi:153883869  
SequenceATGGGATTTAGATTAAAAACGTCAAAAAAAACAAAAGAAATATTTGAAGAATTAGGTGGAAGTTCAAATC
TTAAGCCCTTTGCATTAAGTAAAATAGCCGTTTCTATGTCTCTAAATCATGAAACACCTATTGAAGAATA
TGAAAGTAAGGATACAAATGGACTTGAACTACAAAGAGCTACTGTTACTGGTGAATTTGATGCTATATTC
AAAGCTCTTATTGAAATGAACTTAGGAAGACATATTTCAGATGATGACTACTATCCTACTTATATGAAGC
TTCATATGGATAGAGGTGCTGAACTTCTTTATAATAAATATAAATACTCAGGGGGTAACTTAGAAAAATT
TATAACTAAGATACTTGATGAAGGAGATGCTAGTATATGA