Summary Sequence Alignment 16S rRNA Context  
4 homologues found:

HomologuedndB
OrganismExiguobacterium sp. AT1b
GID1107
PID2107
Locus tagEAT1bDRAFT_1706
Locations23556..24656
Length1101 bp
G+C%36.5
Link NCBI: gi:187605090  
SequenceATGGATCCTAATTTCAGCTATAACTTCCCCGCATTACGAGGAAAACAGGCAGAAAAAGAATATTTCGTCG
TTATGTGCCCGTTAAAACTGATTCCAAAAATTTTCTTATTCGATGAAGAGGAAGTCCCACCACAATACCG
CTCACAGCGGATTTTGAATAAATCTAGAGTTCCAGACATTACAAATTACATTGTAGATCAGTCCAAGGAC
TATGTATTTTCATCCCTTACAGCTTCCATTGATGGTGAAATTCAGTTTACTCCGTTTACAGATGAACCAA
ACTTTAAAGACTTAGGCAAACTCTCGATCGCACTGGATTCCCGTTTTTTAATTAATGATGGTCAACACCG
GAGAGCAGCGATTGAAGAGGCTTTAAAAATTATGCCTGAGCTTGGTAATGAAACAATTTCTGTTGTATTC
TTTCATGATGAAGGTCTAGAACGATCTCAACAAATTTTTTCAGATTTGAATCGACATGCCGTTAACACAA
CGTCATCTATCGGTATTTTATATGATCATCGTGATCAGTTATCGCTCCTTACTAAAGAAATCGTTGAAGA
GATTCCGTTGTTAAAACGGTATACAGAAATGGAGAAAACGTCCCTCTCCAAGAATTCACCAAAACTTTTA
GCGTTAAATCATATTTATAATGCAAATAAACGACTAATTAATAAGAAAAAAGGTGCTCTTTTAACTGAAG
AAGACGCATTGAACATCAAAACGTTTTGGCTAACTCTATGCAATAGTATTCATGAATGGGAACAAGTATT
TAATAAAGAAATCTCCCCTCGTGATTTACGTATGATTTCAATTGCGGGTCAAGGTTTATTTATCGAAGCA
GCGGCTGAAGTTGCGCGCTCTTTAATTGAACAAAAACCTGATACATGGACAGCCTACCTTACAAAATTTA
AAGATATTGATTGGAGCCGTTCAAACGAAAAAGATTGGAAAGGTCGTGCCTTTAACGAAAACGGCAGAAT
TTTAAAGAACAACTACACTATTCGATTGACTGCCATACGAATCAAATCGCTAATCGGCATCAAGCTCACG
AAAGAAGAGAAAGATTTCGATCAACAAAAATCAAGCATGAACGTATTATGA

HomologuedndC
OrganismExiguobacterium sp. AT1b
GID1108
PID2108
Locus tagEAT1bDRAFT_1707
Locations24685..26340
Length1656 bp
G+C%39.1
Link NCBI: gi:187605090  
SequenceATGACACAAGGTATTATTAGTAACTTATTTACTCAACATGAAGGAGATACTGTCTCTAGACGCTCCATCG
ATTTGATCAAACGTGTTTATTTAAATGACACACGTCCATGGGTGGTCGGATTTAGTGGCGGAAAAGATTC
TACACTAACGACTCAACTCATTTTCGAAGCGTTGCTAGAGCTTTCACCAGAACAGTTGCATAAGAAGGTA
TTTATCATTTCTTCTGACACTTTGGTAGAAAACCCACTCGTTGTTTCCATGATTAACGGCTCTTTACACC
GCATGCAAGAAGCCGCTTTTAAATATAATCTCCCAATCGAAACACAAAAAGTTAAACCACTTACAGAAAA
AACTTTTTGGACGAATATTATTGGACGTGGCTACCCTACTCCGAACCAAACGTTTAGATGGTGTACAGAT
CGTCTTAAAATCGACCCTGCTAACCGCTTCATTAAAGATAAAGTGTCAAAATACGGCGAAATTATTATGG
TACTTGGTGTCCGTTCATCTGAGAGCACGAGCCGAGGCCAATCCATAAAAGATCATGAGATTTCAGGTAG
CGAATTGATGCGACACACATCATTAGCGAATGCTTATGTATTTGCCCCAATTAAAGAATTTGTTCTAGAT
GATGTATGGAGCTACCTTCTTCAAAACCCAGCTCCGTGGGGGGAAGACCATCACAAGCTGCAGAAAATGT
ACATGGATTCAAGTAGCGAATGTCCATTAGTCGTTGACCAAAACATTAAAGAAAGTGCTGGTTCTTGTGG
GAATAGCCGTTTCGGTTGCTGGACGTGTACGGTTGTCAATCAAGATAAATCGCTTACTGGCTTTATTCAA
ACTGGTGAACATGACTGGTTAAAACCATTATTGAAGTTCCGCAATAAAATGGTTCTCATTCGTGACGACC
GTTCTAAACGAATGCATAAACGAATGAATGGTGCCTTCTATTTATTAGAAGTTCAACATGAAATCAAAGA
AGATGGAATCTATATTGTTCAAAAGAAAAAAGGCGGTCGTGCTGCCACTTCTCATAAAGTAGTTGACCGA
ATTGAAGATTTGACTGATGAGTCTGTTCTTGCCGTTCCTAAAGCACAATTAAGTCAATTTATCGCAAAAC
ACAATATTGACTTGAGCAAACCTGAAGAGTTCAATATTCAGTTTGTCGTTACCGAAACAAACGAGGATGG
GCAATCTGCATACTCACACCTTGGTCTTGGTCCTTTCACACTAGCTACTAGAAATGAACTAATGCGCGAC
TTATTGATTTTACAACGTGATTTAAAAGTTCCAAATTCAGTCGAGTACAAATTAATTCAGGATGATGAGT
TACGAGCAATTCGTCGCTTATGGCTCCGTGAAGGTGATTGGAACGATACTTTACCAGAACTTTATCGCGA
AGTATTCGGCGTCGACCTGGATTGGGAACATGATGATCGTCAGATTCTAACAAGTGACCAAGCGAATGAT
TTAGAACTTCTTTCTCAAAAGTATGGTCTTGATTTCAATATGGTTCAAAAACTATTTACAACAGCAAATG
ATTTTCTAGGTGTAAAGGTTAAACGAGGATTTAATAAAGATGTCGCTGCGCTATTGAGCCAAGACTATTT
AAGCCTTTACAAAGAGCAAGGAGTTTTAGAGAGAGATGAAGATTGA

HomologuedndD
OrganismExiguobacterium sp. AT1b
GID1109
PID2109
Locus tagEAT1bDRAFT_1708
Locations26330..28342
Length2013 bp
G+C%34.9
Link NCBI: gi:187605090  
SequenceATGAAGATTGAATCGATTGTCTTAAAGAATATTGGAGCATATAAAAATCAAACATTTGATTTCAAGAATG
AAAACTCTAATAAAAATGTTATTTTAATCGGCGGGAAAAATGGAGCGGGTAAAACAACCTTTTTAAACGC
ACTTCGCACTGGATTATATGGTAGTCAGGCGTTTGGGATTAAAGCACCTACTCCATCCTACTTCAAAGAA
ATTGAGAAGTTAATCAATAGCGAAGTAAGAGATCAACGAGAAAGATATAGTACCACTAAACAAATTTCAA
AAATCCAAATTACGTTTACAACAACAACGAATCAAACTACATCACGCTATTTATTTGAACGATCATGGGG
AATCGACGCTAAGAATATTAAAGAATACTTTAACATCTATCGTGATGCAAATACCTTTGCACTAGCAGAG
AAGGATAAGAGTCAAGTCTATTCATTATTCTTAGAACGTACTCCCCTCTATTTGTTTAATGTCTCATTAT
TTGATGGAGAGACAATTAATCAAATTATTAATGAAGGGAAACTGTCTGAGTACCTAGATGATTTGATGAA
AAGTGCATTTAAATTAGAGATTCCAGATTTATTAACGGAAACAATCGAATCACTTGTACGAGACGAAGCC
AAGACTAAGCTATCTAAAGATAAATCAAAACGTTTAGATGAGCTTAAAAAACAGCTAAGTGAATCCGAAC
AAAAATTGCAAAACGTTCAAGTCGATAAATCTCAGCTTCTTCAGAATATCGAAGTTAGTGAAGCCGAAAT
CACTGCCTTCTCTGAATCGTTACGCGCACACGACGTGATTAGTAAAGAAGAAGAAGCAAAATTGAAAGAG
GAAATAAGAAACCTAGAACAAGAACGACAGAAATTAAAGCAATCTACGTCAGACTTTTTCAATGAGTACT
ACGCCTTTTCTATCAATCATCACTTGCTTGAAAAAGCTGCAGAACAAGTAGAATCAGAACTATTGATCAG
AAGTGTAGAAGATTTAGAAAAAGTCTTCACCGATGAGTTCTATAAGAATGTTTCACGTAATTTAGGAGGA
TCTGTAGGACATGATTCACTGAAGAATGAATTCAATGCGGCTTTAAAAACGGCTGTTCCGAAAACTGAAA
TTATTCATGACGCTTCGTTCGGTTCGAAGGCAAAAGTTGAAAATATGATTTCTTCAGTAAACGCTCAATC
TTCCTCATCTCTCTTGGCAAACATTAATCGCGATGACGAAATCATAGAGGAACTGAAGATATTACGAAGA
AAACTAGTGATTCGAGAAGAAAATCATGCGGATTTTGAAAAACAATTTGAGGAATTGAATCAACTCAAAG
TTAGTCATCTTCATTTGAACGAGCAGTTAGAACGTATTGTTAAACTTGAAGAAGATCTCCAAAATCAGTA
CTCGATGTTAGTGGAAGAAAACGCCTCACTTCAACAAGAAATCGAGAAAATCACTTCAAAATCGAGCTTA
TTATCGCAAAATGCGACTTCAACATTAGCTTTACTAGAAGACTTCAAACTTCAACAGCGATATAAAGTCA
TTCGGAGTGTTGAAGAAAATGCGTTACGCATGTTAAAGACATTGATGCGTAAAGAAGATTACGTAGATAA
GCTATCGATTCTACCCGAAGACTTCTCGTTAACTTTGTCATCTAAAGACCAGTCTCAAATTTCTGTAGCT
ACGCTATCTTCTGGTGAGAAACAGATTCTACTTCTTTCATTAATCTGGGCAATTTTCAAAGTTTCCGAAA
ATCAAATGCCATTTATCTTCGATACTTTGTTAGGTCGATTAGATCGAGATCACCGTTATAACATTTTACG
TAACTTACTTCCTAACTTTGGTGAACAAGTGTTAGTGCTATCTACAGACTCAGAGATTAGCAAAGATTAC
TACGACGTACTCAAACCATCGATTTCTAAAGAGTATAGTCTTCAGTTTGATAATGAACATTTAGAAACAC
GAGTCATTCCATCGTATTTTGAATTTGAAAACGCGCAGGTGAAAAACTCATGA

HomologuedndE
OrganismExiguobacterium sp. AT1b
GID1110
PID2110
Locus tagEAT1bDRAFT_1709
Locations28339..28719
Length381 bp
G+C%36.4
Link NCBI: gi:187605090  
SequenceATGAACTACCGTCTTAAATTAACTGAACAAACGCATCTCTATTTTAAAGAGATTGCAAACTCAACTCATA
TCACACCGAACATCCTAGCTCGTTTCGCCGTTGGAATATCATTAAAAAACGAAAAAACTCCATCAAGCGT
TAAAGGTCAGCCCATTTCTAATTTTGAAATAAATCGTGCCACCTTAACGGGAGAACACGACGAGATGTTT
AAAATGATGATTCTTCAACATGCTAAACGCCATATTGAAGAAGAACGATATTTTCCAGATTATTTTAATG
CGCATATTACTCGAGGTGCCGAAGAGCTTTATCAAATGTTCCAATTTTCTAGAAGTACCAATCAATTCTT
AAGAGAGTTATTGGCTCTCCAGGAGGGATAA