Summary Sequence Context  
1 homologue found:

HomologuedndB
OrganismExiguobacterium sp. AT1b
GID1107
PID2107
Locus tagEAT1bDRAFT_1706
Locations23556..24656
Length1101 bp
G+C%36.5
Link NCBI: gi:187605090  
SequenceATGGATCCTAATTTCAGCTATAACTTCCCCGCATTACGAGGAAAACAGGCAGAAAAAGAATATTTCGTCG
TTATGTGCCCGTTAAAACTGATTCCAAAAATTTTCTTATTCGATGAAGAGGAAGTCCCACCACAATACCG
CTCACAGCGGATTTTGAATAAATCTAGAGTTCCAGACATTACAAATTACATTGTAGATCAGTCCAAGGAC
TATGTATTTTCATCCCTTACAGCTTCCATTGATGGTGAAATTCAGTTTACTCCGTTTACAGATGAACCAA
ACTTTAAAGACTTAGGCAAACTCTCGATCGCACTGGATTCCCGTTTTTTAATTAATGATGGTCAACACCG
GAGAGCAGCGATTGAAGAGGCTTTAAAAATTATGCCTGAGCTTGGTAATGAAACAATTTCTGTTGTATTC
TTTCATGATGAAGGTCTAGAACGATCTCAACAAATTTTTTCAGATTTGAATCGACATGCCGTTAACACAA
CGTCATCTATCGGTATTTTATATGATCATCGTGATCAGTTATCGCTCCTTACTAAAGAAATCGTTGAAGA
GATTCCGTTGTTAAAACGGTATACAGAAATGGAGAAAACGTCCCTCTCCAAGAATTCACCAAAACTTTTA
GCGTTAAATCATATTTATAATGCAAATAAACGACTAATTAATAAGAAAAAAGGTGCTCTTTTAACTGAAG
AAGACGCATTGAACATCAAAACGTTTTGGCTAACTCTATGCAATAGTATTCATGAATGGGAACAAGTATT
TAATAAAGAAATCTCCCCTCGTGATTTACGTATGATTTCAATTGCGGGTCAAGGTTTATTTATCGAAGCA
GCGGCTGAAGTTGCGCGCTCTTTAATTGAACAAAAACCTGATACATGGACAGCCTACCTTACAAAATTTA
AAGATATTGATTGGAGCCGTTCAAACGAAAAAGATTGGAAAGGTCGTGCCTTTAACGAAAACGGCAGAAT
TTTAAAGAACAACTACACTATTCGATTGACTGCCATACGAATCAAATCGCTAATCGGCATCAAGCTCACG
AAAGAAGAGAAAGATTTCGATCAACAAAAATCAAGCATGAACGTATTATGA