Summary Sequence Context  
1 homologue found:

HomologuedndC
OrganismExiguobacterium sp. AT1b
GID1108
PID2108
Locus tagEAT1bDRAFT_1707
Locations24685..26340
Length1656 bp
G+C%39.1
Link NCBI: gi:187605090  
SequenceATGACACAAGGTATTATTAGTAACTTATTTACTCAACATGAAGGAGATACTGTCTCTAGACGCTCCATCG
ATTTGATCAAACGTGTTTATTTAAATGACACACGTCCATGGGTGGTCGGATTTAGTGGCGGAAAAGATTC
TACACTAACGACTCAACTCATTTTCGAAGCGTTGCTAGAGCTTTCACCAGAACAGTTGCATAAGAAGGTA
TTTATCATTTCTTCTGACACTTTGGTAGAAAACCCACTCGTTGTTTCCATGATTAACGGCTCTTTACACC
GCATGCAAGAAGCCGCTTTTAAATATAATCTCCCAATCGAAACACAAAAAGTTAAACCACTTACAGAAAA
AACTTTTTGGACGAATATTATTGGACGTGGCTACCCTACTCCGAACCAAACGTTTAGATGGTGTACAGAT
CGTCTTAAAATCGACCCTGCTAACCGCTTCATTAAAGATAAAGTGTCAAAATACGGCGAAATTATTATGG
TACTTGGTGTCCGTTCATCTGAGAGCACGAGCCGAGGCCAATCCATAAAAGATCATGAGATTTCAGGTAG
CGAATTGATGCGACACACATCATTAGCGAATGCTTATGTATTTGCCCCAATTAAAGAATTTGTTCTAGAT
GATGTATGGAGCTACCTTCTTCAAAACCCAGCTCCGTGGGGGGAAGACCATCACAAGCTGCAGAAAATGT
ACATGGATTCAAGTAGCGAATGTCCATTAGTCGTTGACCAAAACATTAAAGAAAGTGCTGGTTCTTGTGG
GAATAGCCGTTTCGGTTGCTGGACGTGTACGGTTGTCAATCAAGATAAATCGCTTACTGGCTTTATTCAA
ACTGGTGAACATGACTGGTTAAAACCATTATTGAAGTTCCGCAATAAAATGGTTCTCATTCGTGACGACC
GTTCTAAACGAATGCATAAACGAATGAATGGTGCCTTCTATTTATTAGAAGTTCAACATGAAATCAAAGA
AGATGGAATCTATATTGTTCAAAAGAAAAAAGGCGGTCGTGCTGCCACTTCTCATAAAGTAGTTGACCGA
ATTGAAGATTTGACTGATGAGTCTGTTCTTGCCGTTCCTAAAGCACAATTAAGTCAATTTATCGCAAAAC
ACAATATTGACTTGAGCAAACCTGAAGAGTTCAATATTCAGTTTGTCGTTACCGAAACAAACGAGGATGG
GCAATCTGCATACTCACACCTTGGTCTTGGTCCTTTCACACTAGCTACTAGAAATGAACTAATGCGCGAC
TTATTGATTTTACAACGTGATTTAAAAGTTCCAAATTCAGTCGAGTACAAATTAATTCAGGATGATGAGT
TACGAGCAATTCGTCGCTTATGGCTCCGTGAAGGTGATTGGAACGATACTTTACCAGAACTTTATCGCGA
AGTATTCGGCGTCGACCTGGATTGGGAACATGATGATCGTCAGATTCTAACAAGTGACCAAGCGAATGAT
TTAGAACTTCTTTCTCAAAAGTATGGTCTTGATTTCAATATGGTTCAAAAACTATTTACAACAGCAAATG
ATTTTCTAGGTGTAAAGGTTAAACGAGGATTTAATAAAGATGTCGCTGCGCTATTGAGCCAAGACTATTT
AAGCCTTTACAAAGAGCAAGGAGTTTTAGAGAGAGATGAAGATTGA