Summary Sequence Context  
1 homologue found:

HomologuedndD
OrganismExiguobacterium sp. AT1b
GID1109
PID2109
Locus tagEAT1bDRAFT_1708
Locations26330..28342
Length2013 bp
G+C%34.9
Link NCBI: gi:187605090  
SequenceATGAAGATTGAATCGATTGTCTTAAAGAATATTGGAGCATATAAAAATCAAACATTTGATTTCAAGAATG
AAAACTCTAATAAAAATGTTATTTTAATCGGCGGGAAAAATGGAGCGGGTAAAACAACCTTTTTAAACGC
ACTTCGCACTGGATTATATGGTAGTCAGGCGTTTGGGATTAAAGCACCTACTCCATCCTACTTCAAAGAA
ATTGAGAAGTTAATCAATAGCGAAGTAAGAGATCAACGAGAAAGATATAGTACCACTAAACAAATTTCAA
AAATCCAAATTACGTTTACAACAACAACGAATCAAACTACATCACGCTATTTATTTGAACGATCATGGGG
AATCGACGCTAAGAATATTAAAGAATACTTTAACATCTATCGTGATGCAAATACCTTTGCACTAGCAGAG
AAGGATAAGAGTCAAGTCTATTCATTATTCTTAGAACGTACTCCCCTCTATTTGTTTAATGTCTCATTAT
TTGATGGAGAGACAATTAATCAAATTATTAATGAAGGGAAACTGTCTGAGTACCTAGATGATTTGATGAA
AAGTGCATTTAAATTAGAGATTCCAGATTTATTAACGGAAACAATCGAATCACTTGTACGAGACGAAGCC
AAGACTAAGCTATCTAAAGATAAATCAAAACGTTTAGATGAGCTTAAAAAACAGCTAAGTGAATCCGAAC
AAAAATTGCAAAACGTTCAAGTCGATAAATCTCAGCTTCTTCAGAATATCGAAGTTAGTGAAGCCGAAAT
CACTGCCTTCTCTGAATCGTTACGCGCACACGACGTGATTAGTAAAGAAGAAGAAGCAAAATTGAAAGAG
GAAATAAGAAACCTAGAACAAGAACGACAGAAATTAAAGCAATCTACGTCAGACTTTTTCAATGAGTACT
ACGCCTTTTCTATCAATCATCACTTGCTTGAAAAAGCTGCAGAACAAGTAGAATCAGAACTATTGATCAG
AAGTGTAGAAGATTTAGAAAAAGTCTTCACCGATGAGTTCTATAAGAATGTTTCACGTAATTTAGGAGGA
TCTGTAGGACATGATTCACTGAAGAATGAATTCAATGCGGCTTTAAAAACGGCTGTTCCGAAAACTGAAA
TTATTCATGACGCTTCGTTCGGTTCGAAGGCAAAAGTTGAAAATATGATTTCTTCAGTAAACGCTCAATC
TTCCTCATCTCTCTTGGCAAACATTAATCGCGATGACGAAATCATAGAGGAACTGAAGATATTACGAAGA
AAACTAGTGATTCGAGAAGAAAATCATGCGGATTTTGAAAAACAATTTGAGGAATTGAATCAACTCAAAG
TTAGTCATCTTCATTTGAACGAGCAGTTAGAACGTATTGTTAAACTTGAAGAAGATCTCCAAAATCAGTA
CTCGATGTTAGTGGAAGAAAACGCCTCACTTCAACAAGAAATCGAGAAAATCACTTCAAAATCGAGCTTA
TTATCGCAAAATGCGACTTCAACATTAGCTTTACTAGAAGACTTCAAACTTCAACAGCGATATAAAGTCA
TTCGGAGTGTTGAAGAAAATGCGTTACGCATGTTAAAGACATTGATGCGTAAAGAAGATTACGTAGATAA
GCTATCGATTCTACCCGAAGACTTCTCGTTAACTTTGTCATCTAAAGACCAGTCTCAAATTTCTGTAGCT
ACGCTATCTTCTGGTGAGAAACAGATTCTACTTCTTTCATTAATCTGGGCAATTTTCAAAGTTTCCGAAA
ATCAAATGCCATTTATCTTCGATACTTTGTTAGGTCGATTAGATCGAGATCACCGTTATAACATTTTACG
TAACTTACTTCCTAACTTTGGTGAACAAGTGTTAGTGCTATCTACAGACTCAGAGATTAGCAAAGATTAC
TACGACGTACTCAAACCATCGATTTCTAAAGAGTATAGTCTTCAGTTTGATAATGAACATTTAGAAACAC
GAGTCATTCCATCGTATTTTGAATTTGAAAACGCGCAGGTGAAAAACTCATGA