Summary Sequence Context  
1 homologue found:

HomologuedndE
OrganismExiguobacterium sp. AT1b
GID1110
PID2110
Locus tagEAT1bDRAFT_1709
Locations28339..28719
Length381 bp
G+C%36.4
Link NCBI: gi:187605090  
SequenceATGAACTACCGTCTTAAATTAACTGAACAAACGCATCTCTATTTTAAAGAGATTGCAAACTCAACTCATA
TCACACCGAACATCCTAGCTCGTTTCGCCGTTGGAATATCATTAAAAAACGAAAAAACTCCATCAAGCGT
TAAAGGTCAGCCCATTTCTAATTTTGAAATAAATCGTGCCACCTTAACGGGAGAACACGACGAGATGTTT
AAAATGATGATTCTTCAACATGCTAAACGCCATATTGAAGAAGAACGATATTTTCCAGATTATTTTAATG
CGCATATTACTCGAGGTGCCGAAGAGCTTTATCAAATGTTCCAATTTTCTAGAAGTACCAATCAATTCTT
AAGAGAGTTATTGGCTCTCCAGGAGGGATAA