Summary Sequence Alignment 16S rRNA Context  
4 homologues found:

HomologuedndB
OrganismDesulfatibacillum alkenivorans AK-01
GID1111
PID2111
Locus tagDalkDRAFT_5059
Locations218391..219485
Length1095 bp
G+C%41.1
Link NCBI: gi:163722278  
SequenceATGGACCCGTCATTTGAGTATATTTTCCCAGCTATTAGAGGAATTCAAGCAGGGCGTGAGTTTTATGTTT
CAATGTGCCCTCTTAGACTCTTGCCCAAAATATTTACGTTTGATGATGAGGAGTTGATCCCTGAACTCAG
AGCTCAACGCGTATTAAATAAGGCTCGGATCCCAGAGATGGCACGGTACATTATCAGTAACATGAATGAT
TACGTGTTTTCAGCAATTACAGCTTCAATAGATGCTAAAGTAAGATTTGAGGCTCTTGGGCAAAGTGGAG
AAGCTAATCGGGTCGGCTCATTGCATATTCCCATGGATGCTAGGTTTATCATCAATGATGGTCAACATAG
GCGGGCTGCAATTGAATTGGCCCTTCGCGAAAAGCCAGATCTTGCAGATGAGACTATCGCAGTAGTTTTC
TTTTTGGATAAAGGGCTTAATAGATGCCAGCAAATGTTTGCAGATTTAAATCGCTATGCTATTCGCCCTA
GTAAATCATTGGGTATATTGTACGACTATAGAGACGATATGGCGCTACTGGCCAAGAGTGTCGTACTTAA
ATCGCCAGTATTCAAGGATGTGGTGGAAATGGAGAAAAGTACGCTTTCCCCCAGAGCGAGAAAACTTTTT
ACCCTAAGCTCAATATACTTTGCAACGAATGAGCTTTTAGAAAGCATTGATGGTTCACAAGAAGAAAAAA
CCAATATGGCTATTAACTATTGGGTTGAAGTTGCAAAATATATCAAAGAATGGAATTTAGTAAGAGCACG
CAAAATGACATCAGCGGAAGTAAGGAGAGAGTTTATACACTCACATGGCATTGCGCTACAATCCATTGGA
AAAGTGGGCAATCATCTATTAAGAAATAATCCTGCCAACTGGAAAAGGACATTGAAAAAAATTGAGAACA
TAGATTGGTCCAGATCCAACTCACAGCTATGGGAAGGTCGCTGTATGATTGGAGGGCGTGTGTCCAAATC
CTCTCATAATGTTACATTAACAACCAATGCTATTAAAGCCGCTCTAAGCCTGCCATTGTCCTCCAGTGAA
ACTCGTGTGGAAGAGGCGTACAAAAGGGGGGATTATGAAAAATGA

HomologuedndC
OrganismDesulfatibacillum alkenivorans AK-01
GID1112
PID2112
Locus tagDalkDRAFT_5060
Locations219475..221001
Length1527 bp
G+C%40.6
Link NCBI: gi:163722278  
SequenceATGAAAAATGACAAAGAAGTTGTTTTGGGGGAATCTTTTGATGATTCGGCCTTTGAAGAGTTGGGTTTCA
ACTCAATTATTGGTCAAATAAATGAAGAAATTCAATCCATTTACCTTGCAGATGAAATTCCATGGGTTAT
TGGATACAGTGGAGGAAAAGATTCAACAGCCATTCTCCAATTAGTATGGCATGCCATTGGACTCTTGCCC
CCACAAAAACGGATTAAACCCATACATGTTATCAGCACAGATACGCTAGTCGAGAATCCTATTGTAGCGC
AATGGGTTGATAGCTCTTTATCCAAAATGAGGATCGCTGCTAAAAATCAAAACCTGCCTATTAGACCTAA
TAAGTTACGTCCTCGAGTTGAAGATACTTTCTGGGTTCATCTTATTGGTAGAGGATACCCCTCACCACGC
CCCTGGTTCCGTTGGTGCACTGACCGTCTGAAAATTTGGCCTTCCAACAACTTTATTAACAGCCTGGTAA
AAAATTATGGTGAAGCCATCTTAGTTTTAGGTTCCAGAAAAGCAGAAAGTTCTCGCAGAGCCCATGTCAT
GAAAACTTTGGAAAAAAAACGTATTCGAGAAAAACTTAGCCCAAACACTCATCTTCCAAATTCTTATGTC
TATACACCTATAGAAAACTGGTCAAATGATGACGTTTGGTTATATTTAGACAATATTGAGAATCCCTGGC
TGGGCACTAATAAGGAACTTTTTGATTTATACAAAGGCGCCACAGAGCAAGGAGAATGCCCATTCGTAAC
CAATAGCACATCTCCAAGCTGTGGAAACAGTAGGTTTGGTTGTTGGGTTTGCACTTTGGTAGCAGAAGAC
AAATCAATGACAGCAATGATCCAAAATGATGAAGATAAAGAATGGTTAATGCCTCTTTTAAAAATACGCA
ATGAGATTGCGGTCAAAGAAGACCGCCATCTTCGTGACTATAGGAGGATGAACGGAGCCGTTCAAATTTT
CAAGGGAAGAACCATCGCTGGCCCTTACAAGCAATCATTCCGAGAAGACTTGCTGAGGAGGCTGTTGGAG
GCTCAGCTTTGGGTCAGGGAGAACGGCCCAGAATCTGTTTCAGATATTGAACTTGTAAGCCTTGAGGAGT
TGAGGGAAATAAGACGGATTTGGCTTACGGACAAGCATGAAATAGAAGATAGTCTTCCTCGAATTTATGA
GTCCGTAATGAATCTACCATTTAAAGAGGGAAGATCTACCAACAATTCTATTTTTCGAGATAAGGAGATT
AACCTTCTCCGAGATCTATGCAATGGAGATGAGCTCCATTTTAGCCTTATACGTGAACTGCTGGATATTG
AACAGGGATATAGGAGCACGGTTCGGAGGGCAGGCCTTTACGAAAAAATTGAAAAAGCCTTTTCTAAGCA
TATTTATAGAGATGAAGAAGATGCAACAGATCGAGCACTAAGACAAAGAGAGGCCATCAAACTCGCTGAA
GAGGGGCATTATGAAAATAAATCCAAGGAAGATTATGATTTTAACAAGGACCGATAG

HomologuedndD
OrganismDesulfatibacillum alkenivorans AK-01
GID1113
PID2113
Locus tagDalkDRAFT_5061
Locations221004..222983
Length1980 bp
G+C%39
Link NCBI: gi:163722278  
SequenceATGATTATTGATGAAATAACTCTTCATAACTTTGGAGTATATGGTGGGCGCCATTGTATCAAACTCACCC
CTCCCTCTGCTGATAAACCGGTCATCTTGTTTGGGGGGCTAAATGGTGCTGGAAAAACAACGCTCTTGGA
CGCCCTTCAATTAGTCCTTTATGGTAAACTTGCCTCTTGTTCCAATCGAAATGGTCAGTCCTATGACGAC
TTTTTATTTAGCTCTATTCACCGTAAAGCTGCCCCCCATGAGGGTGCAGCATTGGAAATCCTCTTTAGAC
ACAACTTAAATGGAAGAGAACAATCTATAAGGGTAAATAGGTCTTGGGTACACAACGGAAATAGATTAAA
GGAGTATTTGGAAGTTGAAAGAAATGGGTCAATCGATAGGGTAATGGCAGATACCTGGGAAGACTACGTG
CAGGACATTATCCCCTCCAGGGTTGCCAATCTGTTCTTTTTTGATGGGGAAAAAATTGAAACTTTTGCCA
ATCTGGATAATGCAAAAAAAATCCTTAGTACGGCTATCCATGCGCTCCTTGGGTTAGATATTATCGATCA
ATTAAAAAATGATCTTAAGGTGCTTGAAAAAAGAAAACAAAAGGCAGGTGTGAGCACTGCCAATAGATCA
AAGTTATCTGTGTTGGAATCGGAAATCACAGCATTAGATGATGAGATAGATTCCAAAGCACAGCGTCGAG
CTGGCCTTCAAAATGATTTAGACAAAAAATATATTCAACTAAAAGATATAGAAGAACTTTTTTCAAGGAG
TGGCGGGAAACTATTCGAACAAATGAAAAAAATCGAATCCGACAAAATCAAGGCAGAAGAATCCCTAAAA
GCAACTGAAACCATTCTTCGGGATCTTGCCTCTGACTCATTGCCTTTATTCATGGTTGGAAAATTAATAG
ACGATATTAGGATTCAAGATTTAGCTGAGCAAGACTACAAAAAAAATTGTCTTTTAAATGACTTTATTAA
GAAAAGAGACGAACAAATTATCAAGACCCTGATTAGAGCCCAAGCCTCAAAAAAAATTTTACAAGCTATA
GATCATTTTTTTGAAAAAGAAGGTGCACAAAGAGCAAATAGCATCGGGCCCAGTGACATATTTTTAAACT
TATCCGATAAAACAAGAAATTATGTTCACAACAATTACGCGGACGAGATGAAAACGAGCGTACTTAGAAC
TAAGACACTGATTGATCAAATATCCGAAATCCAGAATGATATTGATGATCTGGATAGAAAGATTGCGGCC
TCACCGCCACAAGATGCAGTGATTACCATTATTGAAAACAGAGAACGGGTTTCTCTCGAAATAAGGAACT
TAGAAGAATTAATAGAGAGGTTGAGTCAGGAGTTAGAGAATTTAAAAAGAAGGAAGACCATCCTTAAGGA
CTCCCTGACCACTACTATAAAAAGGGTAGTTGAAGAAGACTTTGGTAGTGAGGATATTAGGAGAGCCATT
TCACATTCGAAAAGGGTTAGAAAAACAATAGATAGCTTTAGAAGTATGGTACTTCAAAGCCATGTAGACC
ACATTTCTAATATGATTTTAGAAAGTTTTAAACAGCTAATTCGAAAAGAACATCTTGTTGATCAAATATC
GATTTCTCCAGACGATTTTACTCTTCATCTTTATGGCCAGGATAAAGAGGCTATTAAGCCCACGAGGCTT
TCGGCAGGAGAGCGGCAGCTTTTGGCCGCTTCTATTCTTTGGGGATTAGCTCGCGCTTCAGGTAGGGTTA
TACCTGCAGTAATCGATACCCCTCTGGGGCGCCTGGATTCAGAACACCGGACCCACTTGATCGATCACTA
TTACCCCCATGCGAGCCATCAAGTTGTTCTTCTGTCAACTGATGAGGAGATTACAGAAAAATATTTGGAT
AGAATTATGCCAGTTGTTGGGCGATCCTATATCTTAGAATATCAAGATGAAGCCGATACCACAGCAATTC
GAGAAGGGTATTTTTGGTAG

HomologuedndE
OrganismDesulfatibacillum alkenivorans AK-01
GID1114
PID2114
Locus tagDalkDRAFT_5062
Locations222993..223379
Length387 bp
G+C%40.3
Link NCBI: gi:163722278  
SequenceATGGCAATTGAAAATATTCGTCTATCTGAAGAGGCGAAATCTCGCCTCACACGAATAAAAACCAGAACGG
GCGTAACTCAATGGAACGTACTCTGCCGCTGGGCTTTTTGCCTATCCCTTGCAGAAGAATCCGTTCCTGC
CCCCGCCAATATACCTTCTGACAGTAACGTGGAAATGAAATGGAAGGTATTTGGTGGAGAGCACCACGAG
CTATATTTGGCCCTTTTAGAGCAAAGATGCAAAAAAGATGGGTTTGAAATAAGTAATGAAGTTATCAATG
AGCAATTTAAACTTCATTTGCATAGAGGTATAAACTACTTATTTTCTAACAAGGACGCCTCATCCATAAA
AGACATGCTTATGATAACACTTAACATGAATGACTGA