Summary Sequence Context  
1 homologue found:

HomologuedndB
OrganismDesulfatibacillum alkenivorans AK-01
GID1111
PID2111
Locus tagDalkDRAFT_5059
Locations218391..219485
Length1095 bp
G+C%41.1
Link NCBI: gi:163722278  
SequenceATGGACCCGTCATTTGAGTATATTTTCCCAGCTATTAGAGGAATTCAAGCAGGGCGTGAGTTTTATGTTT
CAATGTGCCCTCTTAGACTCTTGCCCAAAATATTTACGTTTGATGATGAGGAGTTGATCCCTGAACTCAG
AGCTCAACGCGTATTAAATAAGGCTCGGATCCCAGAGATGGCACGGTACATTATCAGTAACATGAATGAT
TACGTGTTTTCAGCAATTACAGCTTCAATAGATGCTAAAGTAAGATTTGAGGCTCTTGGGCAAAGTGGAG
AAGCTAATCGGGTCGGCTCATTGCATATTCCCATGGATGCTAGGTTTATCATCAATGATGGTCAACATAG
GCGGGCTGCAATTGAATTGGCCCTTCGCGAAAAGCCAGATCTTGCAGATGAGACTATCGCAGTAGTTTTC
TTTTTGGATAAAGGGCTTAATAGATGCCAGCAAATGTTTGCAGATTTAAATCGCTATGCTATTCGCCCTA
GTAAATCATTGGGTATATTGTACGACTATAGAGACGATATGGCGCTACTGGCCAAGAGTGTCGTACTTAA
ATCGCCAGTATTCAAGGATGTGGTGGAAATGGAGAAAAGTACGCTTTCCCCCAGAGCGAGAAAACTTTTT
ACCCTAAGCTCAATATACTTTGCAACGAATGAGCTTTTAGAAAGCATTGATGGTTCACAAGAAGAAAAAA
CCAATATGGCTATTAACTATTGGGTTGAAGTTGCAAAATATATCAAAGAATGGAATTTAGTAAGAGCACG
CAAAATGACATCAGCGGAAGTAAGGAGAGAGTTTATACACTCACATGGCATTGCGCTACAATCCATTGGA
AAAGTGGGCAATCATCTATTAAGAAATAATCCTGCCAACTGGAAAAGGACATTGAAAAAAATTGAGAACA
TAGATTGGTCCAGATCCAACTCACAGCTATGGGAAGGTCGCTGTATGATTGGAGGGCGTGTGTCCAAATC
CTCTCATAATGTTACATTAACAACCAATGCTATTAAAGCCGCTCTAAGCCTGCCATTGTCCTCCAGTGAA
ACTCGTGTGGAAGAGGCGTACAAAAGGGGGGATTATGAAAAATGA