Summary Sequence Context  
1 homologue found:

HomologuedndC
OrganismDesulfatibacillum alkenivorans AK-01
GID1112
PID2112
Locus tagDalkDRAFT_5060
Locations219475..221001
Length1527 bp
G+C%40.6
Link NCBI: gi:163722278  
SequenceATGAAAAATGACAAAGAAGTTGTTTTGGGGGAATCTTTTGATGATTCGGCCTTTGAAGAGTTGGGTTTCA
ACTCAATTATTGGTCAAATAAATGAAGAAATTCAATCCATTTACCTTGCAGATGAAATTCCATGGGTTAT
TGGATACAGTGGAGGAAAAGATTCAACAGCCATTCTCCAATTAGTATGGCATGCCATTGGACTCTTGCCC
CCACAAAAACGGATTAAACCCATACATGTTATCAGCACAGATACGCTAGTCGAGAATCCTATTGTAGCGC
AATGGGTTGATAGCTCTTTATCCAAAATGAGGATCGCTGCTAAAAATCAAAACCTGCCTATTAGACCTAA
TAAGTTACGTCCTCGAGTTGAAGATACTTTCTGGGTTCATCTTATTGGTAGAGGATACCCCTCACCACGC
CCCTGGTTCCGTTGGTGCACTGACCGTCTGAAAATTTGGCCTTCCAACAACTTTATTAACAGCCTGGTAA
AAAATTATGGTGAAGCCATCTTAGTTTTAGGTTCCAGAAAAGCAGAAAGTTCTCGCAGAGCCCATGTCAT
GAAAACTTTGGAAAAAAAACGTATTCGAGAAAAACTTAGCCCAAACACTCATCTTCCAAATTCTTATGTC
TATACACCTATAGAAAACTGGTCAAATGATGACGTTTGGTTATATTTAGACAATATTGAGAATCCCTGGC
TGGGCACTAATAAGGAACTTTTTGATTTATACAAAGGCGCCACAGAGCAAGGAGAATGCCCATTCGTAAC
CAATAGCACATCTCCAAGCTGTGGAAACAGTAGGTTTGGTTGTTGGGTTTGCACTTTGGTAGCAGAAGAC
AAATCAATGACAGCAATGATCCAAAATGATGAAGATAAAGAATGGTTAATGCCTCTTTTAAAAATACGCA
ATGAGATTGCGGTCAAAGAAGACCGCCATCTTCGTGACTATAGGAGGATGAACGGAGCCGTTCAAATTTT
CAAGGGAAGAACCATCGCTGGCCCTTACAAGCAATCATTCCGAGAAGACTTGCTGAGGAGGCTGTTGGAG
GCTCAGCTTTGGGTCAGGGAGAACGGCCCAGAATCTGTTTCAGATATTGAACTTGTAAGCCTTGAGGAGT
TGAGGGAAATAAGACGGATTTGGCTTACGGACAAGCATGAAATAGAAGATAGTCTTCCTCGAATTTATGA
GTCCGTAATGAATCTACCATTTAAAGAGGGAAGATCTACCAACAATTCTATTTTTCGAGATAAGGAGATT
AACCTTCTCCGAGATCTATGCAATGGAGATGAGCTCCATTTTAGCCTTATACGTGAACTGCTGGATATTG
AACAGGGATATAGGAGCACGGTTCGGAGGGCAGGCCTTTACGAAAAAATTGAAAAAGCCTTTTCTAAGCA
TATTTATAGAGATGAAGAAGATGCAACAGATCGAGCACTAAGACAAAGAGAGGCCATCAAACTCGCTGAA
GAGGGGCATTATGAAAATAAATCCAAGGAAGATTATGATTTTAACAAGGACCGATAG