Summary Sequence Context  
1 homologue found:

HomologuedndD
OrganismDesulfatibacillum alkenivorans AK-01
GID1113
PID2113
Locus tagDalkDRAFT_5061
Locations221004..222983
Length1980 bp
G+C%39
Link NCBI: gi:163722278  
SequenceATGATTATTGATGAAATAACTCTTCATAACTTTGGAGTATATGGTGGGCGCCATTGTATCAAACTCACCC
CTCCCTCTGCTGATAAACCGGTCATCTTGTTTGGGGGGCTAAATGGTGCTGGAAAAACAACGCTCTTGGA
CGCCCTTCAATTAGTCCTTTATGGTAAACTTGCCTCTTGTTCCAATCGAAATGGTCAGTCCTATGACGAC
TTTTTATTTAGCTCTATTCACCGTAAAGCTGCCCCCCATGAGGGTGCAGCATTGGAAATCCTCTTTAGAC
ACAACTTAAATGGAAGAGAACAATCTATAAGGGTAAATAGGTCTTGGGTACACAACGGAAATAGATTAAA
GGAGTATTTGGAAGTTGAAAGAAATGGGTCAATCGATAGGGTAATGGCAGATACCTGGGAAGACTACGTG
CAGGACATTATCCCCTCCAGGGTTGCCAATCTGTTCTTTTTTGATGGGGAAAAAATTGAAACTTTTGCCA
ATCTGGATAATGCAAAAAAAATCCTTAGTACGGCTATCCATGCGCTCCTTGGGTTAGATATTATCGATCA
ATTAAAAAATGATCTTAAGGTGCTTGAAAAAAGAAAACAAAAGGCAGGTGTGAGCACTGCCAATAGATCA
AAGTTATCTGTGTTGGAATCGGAAATCACAGCATTAGATGATGAGATAGATTCCAAAGCACAGCGTCGAG
CTGGCCTTCAAAATGATTTAGACAAAAAATATATTCAACTAAAAGATATAGAAGAACTTTTTTCAAGGAG
TGGCGGGAAACTATTCGAACAAATGAAAAAAATCGAATCCGACAAAATCAAGGCAGAAGAATCCCTAAAA
GCAACTGAAACCATTCTTCGGGATCTTGCCTCTGACTCATTGCCTTTATTCATGGTTGGAAAATTAATAG
ACGATATTAGGATTCAAGATTTAGCTGAGCAAGACTACAAAAAAAATTGTCTTTTAAATGACTTTATTAA
GAAAAGAGACGAACAAATTATCAAGACCCTGATTAGAGCCCAAGCCTCAAAAAAAATTTTACAAGCTATA
GATCATTTTTTTGAAAAAGAAGGTGCACAAAGAGCAAATAGCATCGGGCCCAGTGACATATTTTTAAACT
TATCCGATAAAACAAGAAATTATGTTCACAACAATTACGCGGACGAGATGAAAACGAGCGTACTTAGAAC
TAAGACACTGATTGATCAAATATCCGAAATCCAGAATGATATTGATGATCTGGATAGAAAGATTGCGGCC
TCACCGCCACAAGATGCAGTGATTACCATTATTGAAAACAGAGAACGGGTTTCTCTCGAAATAAGGAACT
TAGAAGAATTAATAGAGAGGTTGAGTCAGGAGTTAGAGAATTTAAAAAGAAGGAAGACCATCCTTAAGGA
CTCCCTGACCACTACTATAAAAAGGGTAGTTGAAGAAGACTTTGGTAGTGAGGATATTAGGAGAGCCATT
TCACATTCGAAAAGGGTTAGAAAAACAATAGATAGCTTTAGAAGTATGGTACTTCAAAGCCATGTAGACC
ACATTTCTAATATGATTTTAGAAAGTTTTAAACAGCTAATTCGAAAAGAACATCTTGTTGATCAAATATC
GATTTCTCCAGACGATTTTACTCTTCATCTTTATGGCCAGGATAAAGAGGCTATTAAGCCCACGAGGCTT
TCGGCAGGAGAGCGGCAGCTTTTGGCCGCTTCTATTCTTTGGGGATTAGCTCGCGCTTCAGGTAGGGTTA
TACCTGCAGTAATCGATACCCCTCTGGGGCGCCTGGATTCAGAACACCGGACCCACTTGATCGATCACTA
TTACCCCCATGCGAGCCATCAAGTTGTTCTTCTGTCAACTGATGAGGAGATTACAGAAAAATATTTGGAT
AGAATTATGCCAGTTGTTGGGCGATCCTATATCTTAGAATATCAAGATGAAGCCGATACCACAGCAATTC
GAGAAGGGTATTTTTGGTAG