Summary Sequence Context  
1 homologue found:

HomologuedndE
OrganismDesulfatibacillum alkenivorans AK-01
GID1114
PID2114
Locus tagDalkDRAFT_5062
Locations222993..223379
Length387 bp
G+C%40.3
Link NCBI: gi:163722278  
SequenceATGGCAATTGAAAATATTCGTCTATCTGAAGAGGCGAAATCTCGCCTCACACGAATAAAAACCAGAACGG
GCGTAACTCAATGGAACGTACTCTGCCGCTGGGCTTTTTGCCTATCCCTTGCAGAAGAATCCGTTCCTGC
CCCCGCCAATATACCTTCTGACAGTAACGTGGAAATGAAATGGAAGGTATTTGGTGGAGAGCACCACGAG
CTATATTTGGCCCTTTTAGAGCAAAGATGCAAAAAAGATGGGTTTGAAATAAGTAATGAAGTTATCAATG
AGCAATTTAAACTTCATTTGCATAGAGGTATAAACTACTTATTTTCTAACAAGGACGCCTCATCCATAAA
AGACATGCTTATGATAACACTTAACATGAATGACTGA