Summary Sequence Alignment 16S rRNA Context  
4 homologues found:

HomologuedndE
OrganismEscherichia coli SE11
GID1115
PID2115
Locus tagECSE_4576
Locations4780075..4780428
Length354 bp
G+C%44
Link NCBI: gi:209917191  
SequenceATGCTCCCAAATCGAATGGTGCTTAGTCGTCAGACCGAAGACCAGCTCAAGAAGTTAAAGGGATATACTG
GAATTACGCCCAATGTCGCGGCTCGACTAGCATTTTTTCGCTCGGTGGAGAGTGAGTTTCGCTATTCGCC
TGAGCGGGATAGTAAGAAGCTGGATGGCTCGCTAGTGCTGGATAAAATTACGTGGCTTGGGGAAACACTG
CAAGCTACAGAACTGGTGTTAAAGATGCTTTATCCTAATCTCGACCAAAAATTGATAATTAAAGCATGGG
CAGCACATGTTGAGGATGGAATCGCTTCTGTTAGAAACCATCGAAATTTAAGAGACTTTTTAATTTCATT
GTAA

HomologuedndD
OrganismEscherichia coli SE11
GID1116
PID2116
Locus tagECSE_4577
Locations4780428..4782473
Length2046 bp
G+C%46
Link NCBI: gi:209917191  
SequenceGTGAATCCTCTGTTTTGGTCGAGGAGGAAAACGAACGTGCTCATTAAACAATTAGTGTTACATAATTTTC
GAGTATTTAACGGTACTCACACAATTGACCTTGCTCCAAGAAAGCGTCCGCATGAAGTAAATCCTCGCCC
GATTGTTCTATTTGGTGGTTTAAATGGTGCAGGGAAAACATCTATTTTGTCGGCAATTCGACTGGCACTG
TATGGGCGTTTAGCGTTTGGCCCGGCAATGCAGCAGCAGGAGTATGTTGAACAACTCGGAGCGCTGGTGC
ACAACGGGACGTATACAGCAGAGCGTCCGGATGAGGCCGCAGTAGAACTGACCTTTACCTACAACCAAAA
CGGCCATGAGACTGAATTCACCGTCACGCGAAGCTGGAAGAAAGGAAAGAAAGATCGTCTCTCTTTGCAA
CAGGATGGACAACCGCGTAGTGAACTCAGTTATGACCAGTGCCAGGGGTTTTTGAATGAATTAATTCCTC
ACGGTGTTGCCGATCTTTTCTTTTTTGATGGAGAGAAGATTGCGGAGTTGGCGGAAGATGAATCCGGTAA
TATTCTGCGTACAGCAGTGCGTCGTTTGTTAGGACTGGATCTGATCGCCAGACTGCAAAATGACCTGATG
ATTTTTGTCAAACGCCAACAAACCGCACAGTTAGGTGGCTCCCAGCAACAGCAGGTCGAAGCGCTTGAAA
CAAAGATTAAAACGCTTGCCGGTCAGGCTGAGAAATTGCTAGAAGAGGCCGACTTCGTCAACTCGCGGAT
TGAATTTTTATCCCAGGACATTATTCGCCATGAGGGATTGTTAAATGCACAGGGCGGTGCATTTGCCCAG
TCCAAAGCACAGGAAAAACAGAAAGTTGAAACGCTGTTAAAAGAAAAAGAGCGTCTGGAAAAAGCGTTAC
GACAGGAATGTGATGGATCGTTGCCCTATGCGTTAGCGCCTAATACGTTGTCGCGGTTGCTGGAAAAAAT
TGCCAATGAAGCGCAGATCAAGCAGGCGAAAAATTTTGAGACGGAGTTAAATCAATTTTTAACTCAACTC
AAAAATGATATTGCGTTCCGTTCCAGCAGTGAAAGCAGTACGAGAGCCATTGCTACCGAAGCGATTACCA
ATAATTTGGAAGCATATATGGCAGCCAAACCAAAAGGTGATTTGCTGTTTGATATTTCTGAACGTGAAGC
CGGTATGCTCCAGCAGTCCATTGAGCAAGACAGCAAAAAAGCATGGCAGCGTTTTGATATGTACCGCCAA
CAATTAGCGGATATTGAACAACAACTGGAGCAGGCCGCAGCTAATATTGCTCGTGCCCCGGAAGACGAGC
AGTTAATGGATCTCTTTGCAGCATTACGCGAGCTCGACCATAAGCGTGAAAAACAGCGGCAAAAATACCG
CTCACTGCTGGAAGAGGCTAAACGGACGAAACAGCAGCAACTGGACTGTGTTCGTCAGGTACAGAAAGCA
CATGACATCACCCGTAGCCAACATGGTTTGAGCAGCGCATTTAAAAATGCGCAGGAAACCATTAACCTGC
TCGATTACTACAGCGATGTACTTACGCAGGCGCGAGTGAAAAAATTATCGGCTAACTTTGAAATTGCCTA
CCACAAACTGGCTCGTAAAGAGGATTTACAGCTTAATGCGCATATAAATCCGCAGACATTTGATGTTGAA
CTGGTGGATGAAAAGGGTTCGGTGATTAATCGTAAGCTGCTTTCTGCGGGTGAAAAGCAGATTTATGCGA
TTGCCATTCTTGAGGCGCTGGCAAAAACCTCTGGGCGTGATTTCCCGGTGATTATTGATACGCCGTTAGG
GCGTCTGGATTCTCAGCATCGGGATAAATTGATTAATCATTATTTCCCGGAAGCCAGCCATCAGGTTGTG
CTGCTATCCACCGATACTGAAGTGGACGAGCGTTATTTCGTCGATCAACTGCGTGATGATATTTCTCATG
CTTATGAGATTGTGTTTAATGCGCATACTAAATCATCTGCGCTGAAGCCTGGCTATTTCTGGGAATTAAC
AAAGGAGGCTGTCTAA

HomologuedndC
OrganismEscherichia coli SE11
GID1117
PID2117
Locus tagECSE_4578
Locations4782427..4784061
Length1635 bp
G+C%49
Link NCBI: gi:209917191  
SequenceATGAGTAAATTAGTTCAGGCCTATGATTTGGCCGAATACGAAGATTTTATTAATCAGGAGCAGTTCGCTG
GACGCCCTCTGGCCGAATATGTTGCCGAGGTTCAGAGAATTTATTGTGCGGATAAGCGTCCGTGGGTAAT
TGGCTATAGCGGTGGGAAAGATTCTTCCGCCGTGATCACGCTAGTGTATCTGGCCCTGCTTGGCCTGCCC
CCGGAAATGCGCAGCAAAGATGTTTTTGTAGTGTCATCCGATACGCTGGTGGAAACCCCAGTAGTAGTAG
ATTTAATTAAGAAAACGATGTTGCAGATTGAGGCAGGCGCAAAACGTAATGGCCTGCCGATCACTCAACA
TGCGGTAACGCCTAAAACTAATGAAACCTTCTGGGTCAATTTACTGGGGAAAGGTTATCCGGCCCCAACC
CGTAGTTTTCGCTGGTGTACCGAGCGTATGAAAATCAATCCGGTGAGCGACTTTATTAAAGAAAAGATCA
GCCAGTTTGATGAAGTGATTGTTGTCCTCGGCTCACGTAGTAGTGAGAGTGCCTCCCGTGCGCAGGTCAT
CGCAAAGCACAAAATTGATGGCTCACGCTTGGCCCGGCATACCACGCTGGCAAATGCGTTTATCTATACC
CCTATTGATACCTGGGATGTAGAAGACGTCTGGAAACTGCTGCGCGGCGCGTTCCGCTATGCTCCTGAAG
ATATCGACGAATGGGAAAGCCCGTGGGGTGGAAACAATCGTCCTCTGTGGACGCTGTATATGGACTCTTC
CGCACAGGGTGAGTGTCCCTTGGTAATAGACGAAAGTACCCCCTCTTGCGGGAACTCTCGCTTTGGATGC
TGGACCTGTACCGTAGTCACCAAAGATAAAGCGATGGAAAGTCTGATCAAAAATGGCGAAGAGTGGATGT
CGCCATTGCTGAAATATCGTGATCTGCTGGCGTTTACCACCGATCCGGTGAATAAAGACACCTATCGCAA
CTATAAACGCCGTACCGGTAAGGTGAGCTATCAGTACGCTAAAGACGGTGAAGATCGCAGTGCAGAGCGT
AAGCATGTTCCTGGCCCCTACTGGCTCAAATATCGCCAGCAATGGTTAAAAGACTTACTGGAAATTGAGC
GTGATTTAAACGCCCAAGGCCACACGATTACGTTAATCACCGAGCCGGAACTGCACGCTATCCGCCAAGA
GTGGTTGAAGGATCCTAACGAGCCAGACTGGTACGATACGTTGCCGGGGATTTACCGCGAGGTGTATCAA
CGGGATCTGGACTGGGTAGTTGATGATCAATCACGCTTTGATGCCAGCGATGCAGATTTGTTGGTACAGA
TAGCTCAGGGATTTGATGTTGCACCCGAGATGGTCATGAAGCTGATTGAACTGGAAGTATCAATGGAAGG
GTTAAGCCGTCGTCAGGGGATTTTTGACAAGCTTGGTACCATTCTAAAACAGGACTGGGGCAGCCTCGAA
GAGATCCAGCAGCAACAAGCAACACTACAAAAACGTAACGACCGGGATATTCATCAGGAAGAAGTCACCA
AGCTGGAAGCTGAACTTCAGGTTCTACAGCGCAGAATTGTAGACGCCAGTGAATCCTCTGTTTTGGTCGA
GGAGGAAAACGAACGTGCTCATTAA

HomologuedndB
OrganismEscherichia coli SE11
GID1118
PID2118
Locus tagECSE_4579
Locations4784058..4785143
Length1086 bp
G+C%48
Link NCBI: gi:209917191  
SequenceATGGCTAGTGTTGATGCAGACTACTGCTACTCGTTTCCGGCTATACGTGGCATTCAGGCGGGTCGCCCCT
TCTACATTGCCACATGCCCGATGCGTATCATCCCCAAAATTTTTAGCTTTGATGAAAATGATGTCCCCCC
GGAGTTGCGGGCGCAACGCACCCTCAATAAATCTCGCATCCCCGAAATGGTGCGGTATCTTCTTGAAAAC
CCCAAAGATTATGTATTCTCTGCACTAACAGCGTCCATTGCCGTTGACGTCCAGTTTGATGAGTTTCCCG
GCACGAATAATCTAGGGACGTTATGTGTACCGATGGACGCGCAAATCTTGATCAACGACGGTCAGCATCG
TCGTAAAGCGATTGAAGACGCTTTAGACGCTCGCCCGGAACTGGGGCAGGATAACATTCCTGTGCTGTTT
TTTGTCGATGAAGGATTAAAACGCAGCCAACAGATGTTTGCCGATCTGAATAAATATGCTATTCGTCCCA
GCCCATCGTTGGCATCGTTGTATGATCATCGGGATGCCAGTTCAAATCTGGCGCGTTATCTGGCAATGTC
CGTAGAGCCGTTTGTCGGAATGACTGAGTTGGAAAAATCCAGTATCAGTCAGCGGTCAAATAAATTATTT
ACGTTAAGCAGCATCAAACAAGCTACTCGTGCGTTGCTGGGAAAAGATCCTAAAGAGAGCGATTTTGAAG
AATGTACCCAGATAGCAACTCGCTATTGGCAGGCTATTTATCATGTAATGCCGGACTGGCAGTTAGCCGC
AAAAAAGGAAGTTTCACCGGTTCAACTACGTCAGGACTATGTTCATGCTCACGGTATTGGTTTGCAGGCA
CTCGGACAACTGGGGTATACACTGCTGACAGATTACCCTGAGCAGTGGCCTGATAAAATTGCTGCACTCA
AAGCGTTTAACTGGCGCAGAAACAATCCGGATCTTATCAAACGTGCGATGCAGCACGGCAAGTTGAGCAA
AACCAGTACGGCGATCCAGCTCACCTGCAATGCGCTAAAAAACGCACTCTCAATTCCTCTCACTCCTGAA
GAACAGGAGCTTGAAGCTCAAATGGTTGTCTTATGA