Summary Sequence Context  
1 homologue found:

HomologuedndB
OrganismEscherichia coli SE11
GID1118
PID2118
Locus tagECSE_4579
Locations4784058..4785143
Length1086 bp
G+C%48
Link NCBI: gi:209917191  
SequenceATGGCTAGTGTTGATGCAGACTACTGCTACTCGTTTCCGGCTATACGTGGCATTCAGGCGGGTCGCCCCT
TCTACATTGCCACATGCCCGATGCGTATCATCCCCAAAATTTTTAGCTTTGATGAAAATGATGTCCCCCC
GGAGTTGCGGGCGCAACGCACCCTCAATAAATCTCGCATCCCCGAAATGGTGCGGTATCTTCTTGAAAAC
CCCAAAGATTATGTATTCTCTGCACTAACAGCGTCCATTGCCGTTGACGTCCAGTTTGATGAGTTTCCCG
GCACGAATAATCTAGGGACGTTATGTGTACCGATGGACGCGCAAATCTTGATCAACGACGGTCAGCATCG
TCGTAAAGCGATTGAAGACGCTTTAGACGCTCGCCCGGAACTGGGGCAGGATAACATTCCTGTGCTGTTT
TTTGTCGATGAAGGATTAAAACGCAGCCAACAGATGTTTGCCGATCTGAATAAATATGCTATTCGTCCCA
GCCCATCGTTGGCATCGTTGTATGATCATCGGGATGCCAGTTCAAATCTGGCGCGTTATCTGGCAATGTC
CGTAGAGCCGTTTGTCGGAATGACTGAGTTGGAAAAATCCAGTATCAGTCAGCGGTCAAATAAATTATTT
ACGTTAAGCAGCATCAAACAAGCTACTCGTGCGTTGCTGGGAAAAGATCCTAAAGAGAGCGATTTTGAAG
AATGTACCCAGATAGCAACTCGCTATTGGCAGGCTATTTATCATGTAATGCCGGACTGGCAGTTAGCCGC
AAAAAAGGAAGTTTCACCGGTTCAACTACGTCAGGACTATGTTCATGCTCACGGTATTGGTTTGCAGGCA
CTCGGACAACTGGGGTATACACTGCTGACAGATTACCCTGAGCAGTGGCCTGATAAAATTGCTGCACTCA
AAGCGTTTAACTGGCGCAGAAACAATCCGGATCTTATCAAACGTGCGATGCAGCACGGCAAGTTGAGCAA
AACCAGTACGGCGATCCAGCTCACCTGCAATGCGCTAAAAAACGCACTCTCAATTCCTCTCACTCCTGAA
GAACAGGAGCTTGAAGCTCAAATGGTTGTCTTATGA