Summary Sequence Context  
1 homologue found:

HomologuedndC
OrganismEscherichia coli SE11
GID1117
PID2117
Locus tagECSE_4578
Locations4782427..4784061
Length1635 bp
G+C%49
Link NCBI: gi:209917191  
SequenceATGAGTAAATTAGTTCAGGCCTATGATTTGGCCGAATACGAAGATTTTATTAATCAGGAGCAGTTCGCTG
GACGCCCTCTGGCCGAATATGTTGCCGAGGTTCAGAGAATTTATTGTGCGGATAAGCGTCCGTGGGTAAT
TGGCTATAGCGGTGGGAAAGATTCTTCCGCCGTGATCACGCTAGTGTATCTGGCCCTGCTTGGCCTGCCC
CCGGAAATGCGCAGCAAAGATGTTTTTGTAGTGTCATCCGATACGCTGGTGGAAACCCCAGTAGTAGTAG
ATTTAATTAAGAAAACGATGTTGCAGATTGAGGCAGGCGCAAAACGTAATGGCCTGCCGATCACTCAACA
TGCGGTAACGCCTAAAACTAATGAAACCTTCTGGGTCAATTTACTGGGGAAAGGTTATCCGGCCCCAACC
CGTAGTTTTCGCTGGTGTACCGAGCGTATGAAAATCAATCCGGTGAGCGACTTTATTAAAGAAAAGATCA
GCCAGTTTGATGAAGTGATTGTTGTCCTCGGCTCACGTAGTAGTGAGAGTGCCTCCCGTGCGCAGGTCAT
CGCAAAGCACAAAATTGATGGCTCACGCTTGGCCCGGCATACCACGCTGGCAAATGCGTTTATCTATACC
CCTATTGATACCTGGGATGTAGAAGACGTCTGGAAACTGCTGCGCGGCGCGTTCCGCTATGCTCCTGAAG
ATATCGACGAATGGGAAAGCCCGTGGGGTGGAAACAATCGTCCTCTGTGGACGCTGTATATGGACTCTTC
CGCACAGGGTGAGTGTCCCTTGGTAATAGACGAAAGTACCCCCTCTTGCGGGAACTCTCGCTTTGGATGC
TGGACCTGTACCGTAGTCACCAAAGATAAAGCGATGGAAAGTCTGATCAAAAATGGCGAAGAGTGGATGT
CGCCATTGCTGAAATATCGTGATCTGCTGGCGTTTACCACCGATCCGGTGAATAAAGACACCTATCGCAA
CTATAAACGCCGTACCGGTAAGGTGAGCTATCAGTACGCTAAAGACGGTGAAGATCGCAGTGCAGAGCGT
AAGCATGTTCCTGGCCCCTACTGGCTCAAATATCGCCAGCAATGGTTAAAAGACTTACTGGAAATTGAGC
GTGATTTAAACGCCCAAGGCCACACGATTACGTTAATCACCGAGCCGGAACTGCACGCTATCCGCCAAGA
GTGGTTGAAGGATCCTAACGAGCCAGACTGGTACGATACGTTGCCGGGGATTTACCGCGAGGTGTATCAA
CGGGATCTGGACTGGGTAGTTGATGATCAATCACGCTTTGATGCCAGCGATGCAGATTTGTTGGTACAGA
TAGCTCAGGGATTTGATGTTGCACCCGAGATGGTCATGAAGCTGATTGAACTGGAAGTATCAATGGAAGG
GTTAAGCCGTCGTCAGGGGATTTTTGACAAGCTTGGTACCATTCTAAAACAGGACTGGGGCAGCCTCGAA
GAGATCCAGCAGCAACAAGCAACACTACAAAAACGTAACGACCGGGATATTCATCAGGAAGAAGTCACCA
AGCTGGAAGCTGAACTTCAGGTTCTACAGCGCAGAATTGTAGACGCCAGTGAATCCTCTGTTTTGGTCGA
GGAGGAAAACGAACGTGCTCATTAA