Summary Sequence Context  
1 homologue found:

HomologuedndD
OrganismEscherichia coli SE11
GID1116
PID2116
Locus tagECSE_4577
Locations4780428..4782473
Length2046 bp
G+C%46
Link NCBI: gi:209917191  
SequenceGTGAATCCTCTGTTTTGGTCGAGGAGGAAAACGAACGTGCTCATTAAACAATTAGTGTTACATAATTTTC
GAGTATTTAACGGTACTCACACAATTGACCTTGCTCCAAGAAAGCGTCCGCATGAAGTAAATCCTCGCCC
GATTGTTCTATTTGGTGGTTTAAATGGTGCAGGGAAAACATCTATTTTGTCGGCAATTCGACTGGCACTG
TATGGGCGTTTAGCGTTTGGCCCGGCAATGCAGCAGCAGGAGTATGTTGAACAACTCGGAGCGCTGGTGC
ACAACGGGACGTATACAGCAGAGCGTCCGGATGAGGCCGCAGTAGAACTGACCTTTACCTACAACCAAAA
CGGCCATGAGACTGAATTCACCGTCACGCGAAGCTGGAAGAAAGGAAAGAAAGATCGTCTCTCTTTGCAA
CAGGATGGACAACCGCGTAGTGAACTCAGTTATGACCAGTGCCAGGGGTTTTTGAATGAATTAATTCCTC
ACGGTGTTGCCGATCTTTTCTTTTTTGATGGAGAGAAGATTGCGGAGTTGGCGGAAGATGAATCCGGTAA
TATTCTGCGTACAGCAGTGCGTCGTTTGTTAGGACTGGATCTGATCGCCAGACTGCAAAATGACCTGATG
ATTTTTGTCAAACGCCAACAAACCGCACAGTTAGGTGGCTCCCAGCAACAGCAGGTCGAAGCGCTTGAAA
CAAAGATTAAAACGCTTGCCGGTCAGGCTGAGAAATTGCTAGAAGAGGCCGACTTCGTCAACTCGCGGAT
TGAATTTTTATCCCAGGACATTATTCGCCATGAGGGATTGTTAAATGCACAGGGCGGTGCATTTGCCCAG
TCCAAAGCACAGGAAAAACAGAAAGTTGAAACGCTGTTAAAAGAAAAAGAGCGTCTGGAAAAAGCGTTAC
GACAGGAATGTGATGGATCGTTGCCCTATGCGTTAGCGCCTAATACGTTGTCGCGGTTGCTGGAAAAAAT
TGCCAATGAAGCGCAGATCAAGCAGGCGAAAAATTTTGAGACGGAGTTAAATCAATTTTTAACTCAACTC
AAAAATGATATTGCGTTCCGTTCCAGCAGTGAAAGCAGTACGAGAGCCATTGCTACCGAAGCGATTACCA
ATAATTTGGAAGCATATATGGCAGCCAAACCAAAAGGTGATTTGCTGTTTGATATTTCTGAACGTGAAGC
CGGTATGCTCCAGCAGTCCATTGAGCAAGACAGCAAAAAAGCATGGCAGCGTTTTGATATGTACCGCCAA
CAATTAGCGGATATTGAACAACAACTGGAGCAGGCCGCAGCTAATATTGCTCGTGCCCCGGAAGACGAGC
AGTTAATGGATCTCTTTGCAGCATTACGCGAGCTCGACCATAAGCGTGAAAAACAGCGGCAAAAATACCG
CTCACTGCTGGAAGAGGCTAAACGGACGAAACAGCAGCAACTGGACTGTGTTCGTCAGGTACAGAAAGCA
CATGACATCACCCGTAGCCAACATGGTTTGAGCAGCGCATTTAAAAATGCGCAGGAAACCATTAACCTGC
TCGATTACTACAGCGATGTACTTACGCAGGCGCGAGTGAAAAAATTATCGGCTAACTTTGAAATTGCCTA
CCACAAACTGGCTCGTAAAGAGGATTTACAGCTTAATGCGCATATAAATCCGCAGACATTTGATGTTGAA
CTGGTGGATGAAAAGGGTTCGGTGATTAATCGTAAGCTGCTTTCTGCGGGTGAAAAGCAGATTTATGCGA
TTGCCATTCTTGAGGCGCTGGCAAAAACCTCTGGGCGTGATTTCCCGGTGATTATTGATACGCCGTTAGG
GCGTCTGGATTCTCAGCATCGGGATAAATTGATTAATCATTATTTCCCGGAAGCCAGCCATCAGGTTGTG
CTGCTATCCACCGATACTGAAGTGGACGAGCGTTATTTCGTCGATCAACTGCGTGATGATATTTCTCATG
CTTATGAGATTGTGTTTAATGCGCATACTAAATCATCTGCGCTGAAGCCTGGCTATTTCTGGGAATTAAC
AAAGGAGGCTGTCTAA