Summary Sequence Context  
1 homologue found:

HomologuedndE
OrganismEscherichia coli SE11
GID1115
PID2115
Locus tagECSE_4576
Locations4780075..4780428
Length354 bp
G+C%44
Link NCBI: gi:209917191  
SequenceATGCTCCCAAATCGAATGGTGCTTAGTCGTCAGACCGAAGACCAGCTCAAGAAGTTAAAGGGATATACTG
GAATTACGCCCAATGTCGCGGCTCGACTAGCATTTTTTCGCTCGGTGGAGAGTGAGTTTCGCTATTCGCC
TGAGCGGGATAGTAAGAAGCTGGATGGCTCGCTAGTGCTGGATAAAATTACGTGGCTTGGGGAAACACTG
CAAGCTACAGAACTGGTGTTAAAGATGCTTTATCCTAATCTCGACCAAAAATTGATAATTAAAGCATGGG
CAGCACATGTTGAGGATGGAATCGCTTCTGTTAGAAACCATCGAAATTTAAGAGACTTTTTAATTTCATT
GTAA