Summary Sequence Alignment 16S rRNA Context  
4 homologues found:

HomologuedndB
OrganismEscherichia coli 55989
GID1119
PID2119
Locus tagEC55989_4841
Locations4962836..4963921
Length1086 bp
G+C%46
Link NCBI: gi:218693476  
SequenceATGGCTAGTGTTGATGCAGACTACTGCTACTCGTTTCCGGCTATACGTGGCATTCAGGCAGGCCGCCCCT
TCTACATTGCCACATGTCCGATGCGTATCATCCCCAAAATTTTTAGCTTTGATGAAAATGATGTTCCTCC
GGAGTTGCGCGCGCAACGCACCCTCAATAAATCTCGCATCCCTGAAATGGTTCGTTATCTTCTTGAAAAT
CCTAAAGATTATGTATTTTCTGCACTAACAGCATCCATTGCCGTTGACGTCCAGTTTGATGAGTTTCCCG
GCACGAATAATCTAGGGACGTTATGTGTACCAATGGACGCGCAAATCTTGATCAACGACGGTCAGCATCG
TCGTAAAGCGATTGAAGACGCTTTAGACGCTCGCCCGGAGCTGGGGCAGGATAACATACCTGTGCTGTTT
TTTGTCGATGAAGGATTAAAACGCAGCCAACAGATGTTTGCCGATCTGAATAAATATGCTATTCGCCCCA
GTCCGTCGTTGGCATCGTTGTATGATCATCGGGATGCCAGTTCAAATTTGGCGCGTTATCTGGCAATGTC
CGTAGAGCCGTTTGTCGGAATGACTGAGCTGGAAAAATCCAATATCAGTCAGCGGTCAAATAAATTATTT
ACGTTAAGCAGCATCAAGCAAGCTACCCGTGCGTTGCTGGGAAAAGATCCGAAAAAGAGCGATTTTGAAG
AATGTACCCAGATAGCAACTCGCTATTGGCAAGCTATTTATAATGTAATGCCGGACTGGCAATTAGCCGC
AAAAAAGGAAGTTTCACCGGTTCAACTACGTCAGGACTATGTTCACGCTCACGGTATTGGTTTGCAGGCA
CTCGGACAACTAGGGTATACACTGCTGACAAATTACCCAGAGCAGTGGCCTGATAAAATTGCTGCACTCA
AAGTGTTTAACTGGCGCAGAAATAATCCGGATCTTATCAAACGTGCGATGCAGCATGGAAAGTTGAGCAA
AACCAGTACGGCAATCCAACTCACCTGCAATGCGCTAAAAAACGCACTCTCAATTCCGCTTACTCCTGAA
GAACAGGAGCTTGAAGCCCAAATGGTTGTCTCATGA

HomologuedndC
OrganismEscherichia coli 55989
GID1120
PID2120
Locus tagEC55989_4840
Locations4961205..4962839
Length1635 bp
G+C%48
Link NCBI: gi:218693476  
SequenceATGAGTAAATTAGTTCAGGCCTACGATTTGGCCGAATACACAGATTTTATTAATCAGGAGCAGTTTTCTG
GACGCCCTCTGGCCGAATATATTTCTGAAGTTCAGAGAATTTATTGTGCGGATAAGCGTCCGTGGGTAAT
TGGCTATAGCGGTGGAAAAGATTCTTCCGCCGTGATCACGCTGGTGTATCTGGCCCTGCTTGGCCTGCCC
CCGGAAATGCGCAACAAAGATGTTTTTGTAGTGTCATCCGATACGCTGGTGGAAACACCAGTGGTAGTAG
ATTTAATTAAGAAAACGATGTTGCAAATTGAGGCAGGCGCAAAGCGTAATGGCCTGCCGATCACTCAACA
TGCGGTAACGCCTAAAACTAATGAAACCTTCTGGGTCAATTTACTGGGGAAAGGTTATCCGGCCCCAACC
CGCAGTTTTCGCTGGTGTACCGAACGCATGAAAATCAATCCGGTGAGTGACTTTATTAAAGAAAAGGTCA
GCCAGTTTGATGAAGTAATTGTTGTCCTAGGTTCACGTAGTAGTGAGAGTGCCTCTCGTGCGCAGGTCAT
CGCAAAGCACAAAATTGATGGCTCACGCTTGGCCCGGCATACCACACTGGCAAATGCGTTTATCTATACC
CCTATTGATACCTGGGATGTAGAAGACGTCTGGAAACTGCTGCGCGGCGCGTTCCGCTATGCTCCTGAAT
ATATCGACGAATGGGAAAGCCCGTGGGGTGGAAACAATCGTCCTCTATGGACGCTGTATATGGACTCTTC
CGCACAGGGTGAGTGTCCCTTAGTGATAGACGAAAGTACCCCCTCTTGTGGGAACTCTCGCTTTGGATGC
TGGACCTGTACCGTAGTAACCAAAGATAAAGCGATGGAAAGTCTGATCAAAAATGGCGAAGAGTGGATGT
CGCCATTGCTGAAATATCGTGATCTGCTGGCGTTTACCACCGATCCGGTGAATAAAGACACCTATCGCAA
CTATAAACGTCGTACCGGTAAGGTGAGCTATCAGTACGCTAAAGACGGTGAAGATCGCAGTGCAGAGCGT
AAGCATGTGCCAGGCCCCTACTGGCTCAAATATCGCCAGCAATGGTTAAAAGACTTACTGGAAATTGAGC
GTGATTTAAACGCCCAGGGCCACAGGATTACGTTAATCACCGAGTCGGAACTGCACGCTATCCGCCAAGA
ATGGTTGAAGGATCCTAATGAACCAGACTGGTACGACACACTACCAGGTATCTACCGTGAGGTGTACCAG
CGGGATCTGGATTGGGTCGTTGACGACCAATCACGTTTTGACGCCAGCGATGCCGATTTGCTGGTGCAGA
TAGCTCAGGGGTTTGATGTTGTGCCAGAGATGGTGATGAAATTGATTGAGCTGGAAGTTTCAATGGAAGG
ATTAAGTCGCCGTCAGGGGATTTTTGACAAACTTGGCACCATTTTAAAACAGGATTGGGGCAGTCTCGAA
GAGATTCAACAACAGCAGGCAGCGCTACAAAAACGTAACGACCGGGATATTCACCAGGAAGAAATCACCA
GGCTGGAAGCTGAACTTCAGGTTTTACAACGCAGAATTGTCGATGCCAGCGAATCCTCTGTATTGGTCGG
CGAGGAAAACGAACGTGCTCATTAA

HomologuedndD
OrganismEscherichia coli 55989
GID1121
PID2121
Locus tagEC55989_4839
Locations4959215..4961263
Length2049 bp
G+C%44
Link NCBI: gi:218693476  
SequenceTTGTCGATGCCAGCGAATCCTCTGTATTGGTCGGCGAGGAAAACGAACGTGCTCATTAAACAACTGGTAT
TACATAATTTTCGGGTATTTAACGGTACTCACACGATTGATCTGGCTCCAAGAAAGCGACCACATGAAGT
AAACCCTCGTCCGATTGTGCTGTTTGGCGGTTTAAATGGTGCAGGTAAAACGTCTATTCTGTCGGCTATC
CGGCTGGCATTGTATGGGCGGCTGGCATTTGGGCTCGCGACTCAGCAACAGGATTATATTGAGCATCTTA
GTTCGTTGATTCACAAAGGTGCGTACTATATTGAGCAACCGGAAGAGGCGGCTGTTGAACTGACCTTTAC
CTATAATAAGGGTGGGCAGGAATCAGAGTTTACTGTTACGCGAACTTGGAAAAAGGGCAAGAAAGATCGC
CTTTCTTTACAAAAGGATGGCCAACCACTCAGTGAACTGGATTATGATCAGTGCCAGGGGTTTCTTAATG
AATTAATTCCTCATGGTATTGCTGATTTGTTCTTTTTTGATGGCGAAAAAATTGCGGAACTGGCAGAAGA
TGAATCTGGCAATATTTTGCGCACCGCTGTACGCCGTTTATTGGGCCTGGATCTGATATCCAAACTGCGT
AATGACTTAATGATTTTCGTTAAGCGCCAACAATCCAGCCAGTTAGCGGAAACTCAGCAACAGCAGATTG
AAGTGCTGGAAAAACAAAGTAGAGACTTAGCTTGTCAGACAGAAGCATTGCTGGAAAAAGCTGATTTTGC
CAAATCTAGAATCGAGTTTCTGTCTAAAGACATTATTCGCTATGAAGGCTTGTTGAATGCGCAGGGCGGT
GCATTTGCGCAGACAAAAGCGCAGGAGAAGCAGAAAGTTGAAACACTGCTAAAAGATAAGGAGCGCCTGG
AAAAAGCACTGCGTCAGGAATGTGATGGATCATTACCTTATGCACTAGCTCCCAATATTTTATCCGAGTT
GCTGGAAAAAATTGCTGATGAAACGCAGATCAAACAAGCTCAAAGCTTTGAAAAAGAGTTAAGGCTATTT
TTGGCCCAGCTCAGAAACGATATTGCATTACGCTCTCGTACTACCAGTAAAATTGCAGCCGAGGCGATTA
CTGATAATCTGAACGAATATATGGCAACTAAGCCGAAGGGCGATTTGTTGTTTGATATTTCTGAACGTGA
AGCCGGCATGCTCCAGCAATCAATAGAGCAGGACAGTAAAAAGGCATGGCAGCGCTTCGAGCTTTACCGT
ATTCAGTTAGCAGAAATTGAACAGCAACTAGAGCAAGCCGCTGCCAATATTGCCCGCGCTCCGGAAGATG
AGCAGTTAATGGATATTTTTGAAAAGCTGCGCGATCTTGATAAGCAGCGTGAAAATCAGCGGCAAAAATA
TCTTTCATTGCTGGAAGACGCTAAACGGGTTAAGCAACAGCAACTGGATTGTGTCCGTCAGGTGCAAAAA
CTGCATGATGCGGCCCGCAGTCAGCATGGCTTTAGTAGCGCCTTCAAAAATGCGCAGGAAACAATTAATT
TACTCGATCGGTATAGCGACGTATTAACTCAGGCGAGAGTAAAGACGCTATCTGCTAACTTTGAAGTTGC
CTATCGCAAACTGGCTCGTAAAGAAGATATGCAACTGAGTGCTCATATTAACCCAGAGACATTTGACGTT
GAGTTAATTGATGAGAAGGGATCTGTCATTAATCGTAAGTTACTATCTGCCGGTGAAAAGCAGATTTATG
CCATTGCTATTCTTGAGGCGCTAGCAAAAACTTCTGGTCGTGATTTGCCGGTGATTATTGATACGCCATT
AGGACGTCTGGATTCACAACATCGGGATAAACTAATTAACCATTATTTCCCATTTGCCAGCCATCAAGTG
GTGCTATTGTCTACCGATACGGAAGTGGATGAACGTTATTTTGTTGACCAATTACGTGATGATATTTCTC
ATGCTTACGAGATAGTATTTAACACGCATACTAAATCATCAGCGTTGAAGCCCGGTTATTTCTGGGAATT
AACTAAGGAGGCTATCTGA

HomologuedndE
OrganismEscherichia coli 55989
GID1122
PID2122
Locus tagEC55989_4838
Locations4958859..4959215
Length357 bp
G+C%44
Link NCBI: gi:218693476  
SequenceATGCTCCCGAATCGAATGGTGCTGAATCGTCAGACTGAAGAGCAGCTTAAAAGATTGAAAGGGTATACAG
GGATCACACCTAATGTCGCTGCCCGATTGGCATTTTTCCGCTCGGTGGAGAGTGAGTTTCGCTATTCATC
AGAACGGGATAATCGGAAACTAGATGGTTCGCTGGTGTTGGATAAGATTACGTGGCTGGGGGAGACATTA
CAGACTACGGAATTGGTATTGAAGATGCTTTATCCGCAGTTAGCTCAGAAGGATATGGTTAAAGCATGGG
CTGCGCATGTGGAGGATGGGATTGCGGCGTTAAGGAATCATAAGAGTCTATTAAACTTTATTAAATCAAT
AGATTAA