Summary Sequence Context  
1 homologue found:

HomologuedndB
OrganismEscherichia coli 55989
GID1119
PID2119
Locus tagEC55989_4841
Locations4962836..4963921
Length1086 bp
G+C%46
Link NCBI: gi:218693476  
SequenceATGGCTAGTGTTGATGCAGACTACTGCTACTCGTTTCCGGCTATACGTGGCATTCAGGCAGGCCGCCCCT
TCTACATTGCCACATGTCCGATGCGTATCATCCCCAAAATTTTTAGCTTTGATGAAAATGATGTTCCTCC
GGAGTTGCGCGCGCAACGCACCCTCAATAAATCTCGCATCCCTGAAATGGTTCGTTATCTTCTTGAAAAT
CCTAAAGATTATGTATTTTCTGCACTAACAGCATCCATTGCCGTTGACGTCCAGTTTGATGAGTTTCCCG
GCACGAATAATCTAGGGACGTTATGTGTACCAATGGACGCGCAAATCTTGATCAACGACGGTCAGCATCG
TCGTAAAGCGATTGAAGACGCTTTAGACGCTCGCCCGGAGCTGGGGCAGGATAACATACCTGTGCTGTTT
TTTGTCGATGAAGGATTAAAACGCAGCCAACAGATGTTTGCCGATCTGAATAAATATGCTATTCGCCCCA
GTCCGTCGTTGGCATCGTTGTATGATCATCGGGATGCCAGTTCAAATTTGGCGCGTTATCTGGCAATGTC
CGTAGAGCCGTTTGTCGGAATGACTGAGCTGGAAAAATCCAATATCAGTCAGCGGTCAAATAAATTATTT
ACGTTAAGCAGCATCAAGCAAGCTACCCGTGCGTTGCTGGGAAAAGATCCGAAAAAGAGCGATTTTGAAG
AATGTACCCAGATAGCAACTCGCTATTGGCAAGCTATTTATAATGTAATGCCGGACTGGCAATTAGCCGC
AAAAAAGGAAGTTTCACCGGTTCAACTACGTCAGGACTATGTTCACGCTCACGGTATTGGTTTGCAGGCA
CTCGGACAACTAGGGTATACACTGCTGACAAATTACCCAGAGCAGTGGCCTGATAAAATTGCTGCACTCA
AAGTGTTTAACTGGCGCAGAAATAATCCGGATCTTATCAAACGTGCGATGCAGCATGGAAAGTTGAGCAA
AACCAGTACGGCAATCCAACTCACCTGCAATGCGCTAAAAAACGCACTCTCAATTCCGCTTACTCCTGAA
GAACAGGAGCTTGAAGCCCAAATGGTTGTCTCATGA