Summary Sequence Context  
1 homologue found:

HomologuedndC
OrganismEscherichia coli 55989
GID1120
PID2120
Locus tagEC55989_4840
Locations4961205..4962839
Length1635 bp
G+C%48
Link NCBI: gi:218693476  
SequenceATGAGTAAATTAGTTCAGGCCTACGATTTGGCCGAATACACAGATTTTATTAATCAGGAGCAGTTTTCTG
GACGCCCTCTGGCCGAATATATTTCTGAAGTTCAGAGAATTTATTGTGCGGATAAGCGTCCGTGGGTAAT
TGGCTATAGCGGTGGAAAAGATTCTTCCGCCGTGATCACGCTGGTGTATCTGGCCCTGCTTGGCCTGCCC
CCGGAAATGCGCAACAAAGATGTTTTTGTAGTGTCATCCGATACGCTGGTGGAAACACCAGTGGTAGTAG
ATTTAATTAAGAAAACGATGTTGCAAATTGAGGCAGGCGCAAAGCGTAATGGCCTGCCGATCACTCAACA
TGCGGTAACGCCTAAAACTAATGAAACCTTCTGGGTCAATTTACTGGGGAAAGGTTATCCGGCCCCAACC
CGCAGTTTTCGCTGGTGTACCGAACGCATGAAAATCAATCCGGTGAGTGACTTTATTAAAGAAAAGGTCA
GCCAGTTTGATGAAGTAATTGTTGTCCTAGGTTCACGTAGTAGTGAGAGTGCCTCTCGTGCGCAGGTCAT
CGCAAAGCACAAAATTGATGGCTCACGCTTGGCCCGGCATACCACACTGGCAAATGCGTTTATCTATACC
CCTATTGATACCTGGGATGTAGAAGACGTCTGGAAACTGCTGCGCGGCGCGTTCCGCTATGCTCCTGAAT
ATATCGACGAATGGGAAAGCCCGTGGGGTGGAAACAATCGTCCTCTATGGACGCTGTATATGGACTCTTC
CGCACAGGGTGAGTGTCCCTTAGTGATAGACGAAAGTACCCCCTCTTGTGGGAACTCTCGCTTTGGATGC
TGGACCTGTACCGTAGTAACCAAAGATAAAGCGATGGAAAGTCTGATCAAAAATGGCGAAGAGTGGATGT
CGCCATTGCTGAAATATCGTGATCTGCTGGCGTTTACCACCGATCCGGTGAATAAAGACACCTATCGCAA
CTATAAACGTCGTACCGGTAAGGTGAGCTATCAGTACGCTAAAGACGGTGAAGATCGCAGTGCAGAGCGT
AAGCATGTGCCAGGCCCCTACTGGCTCAAATATCGCCAGCAATGGTTAAAAGACTTACTGGAAATTGAGC
GTGATTTAAACGCCCAGGGCCACAGGATTACGTTAATCACCGAGTCGGAACTGCACGCTATCCGCCAAGA
ATGGTTGAAGGATCCTAATGAACCAGACTGGTACGACACACTACCAGGTATCTACCGTGAGGTGTACCAG
CGGGATCTGGATTGGGTCGTTGACGACCAATCACGTTTTGACGCCAGCGATGCCGATTTGCTGGTGCAGA
TAGCTCAGGGGTTTGATGTTGTGCCAGAGATGGTGATGAAATTGATTGAGCTGGAAGTTTCAATGGAAGG
ATTAAGTCGCCGTCAGGGGATTTTTGACAAACTTGGCACCATTTTAAAACAGGATTGGGGCAGTCTCGAA
GAGATTCAACAACAGCAGGCAGCGCTACAAAAACGTAACGACCGGGATATTCACCAGGAAGAAATCACCA
GGCTGGAAGCTGAACTTCAGGTTTTACAACGCAGAATTGTCGATGCCAGCGAATCCTCTGTATTGGTCGG
CGAGGAAAACGAACGTGCTCATTAA