Summary Sequence Context  
1 homologue found:

HomologuedndD
OrganismEscherichia coli 55989
GID1121
PID2121
Locus tagEC55989_4839
Locations4959215..4961263
Length2049 bp
G+C%44
Link NCBI: gi:218693476  
SequenceTTGTCGATGCCAGCGAATCCTCTGTATTGGTCGGCGAGGAAAACGAACGTGCTCATTAAACAACTGGTAT
TACATAATTTTCGGGTATTTAACGGTACTCACACGATTGATCTGGCTCCAAGAAAGCGACCACATGAAGT
AAACCCTCGTCCGATTGTGCTGTTTGGCGGTTTAAATGGTGCAGGTAAAACGTCTATTCTGTCGGCTATC
CGGCTGGCATTGTATGGGCGGCTGGCATTTGGGCTCGCGACTCAGCAACAGGATTATATTGAGCATCTTA
GTTCGTTGATTCACAAAGGTGCGTACTATATTGAGCAACCGGAAGAGGCGGCTGTTGAACTGACCTTTAC
CTATAATAAGGGTGGGCAGGAATCAGAGTTTACTGTTACGCGAACTTGGAAAAAGGGCAAGAAAGATCGC
CTTTCTTTACAAAAGGATGGCCAACCACTCAGTGAACTGGATTATGATCAGTGCCAGGGGTTTCTTAATG
AATTAATTCCTCATGGTATTGCTGATTTGTTCTTTTTTGATGGCGAAAAAATTGCGGAACTGGCAGAAGA
TGAATCTGGCAATATTTTGCGCACCGCTGTACGCCGTTTATTGGGCCTGGATCTGATATCCAAACTGCGT
AATGACTTAATGATTTTCGTTAAGCGCCAACAATCCAGCCAGTTAGCGGAAACTCAGCAACAGCAGATTG
AAGTGCTGGAAAAACAAAGTAGAGACTTAGCTTGTCAGACAGAAGCATTGCTGGAAAAAGCTGATTTTGC
CAAATCTAGAATCGAGTTTCTGTCTAAAGACATTATTCGCTATGAAGGCTTGTTGAATGCGCAGGGCGGT
GCATTTGCGCAGACAAAAGCGCAGGAGAAGCAGAAAGTTGAAACACTGCTAAAAGATAAGGAGCGCCTGG
AAAAAGCACTGCGTCAGGAATGTGATGGATCATTACCTTATGCACTAGCTCCCAATATTTTATCCGAGTT
GCTGGAAAAAATTGCTGATGAAACGCAGATCAAACAAGCTCAAAGCTTTGAAAAAGAGTTAAGGCTATTT
TTGGCCCAGCTCAGAAACGATATTGCATTACGCTCTCGTACTACCAGTAAAATTGCAGCCGAGGCGATTA
CTGATAATCTGAACGAATATATGGCAACTAAGCCGAAGGGCGATTTGTTGTTTGATATTTCTGAACGTGA
AGCCGGCATGCTCCAGCAATCAATAGAGCAGGACAGTAAAAAGGCATGGCAGCGCTTCGAGCTTTACCGT
ATTCAGTTAGCAGAAATTGAACAGCAACTAGAGCAAGCCGCTGCCAATATTGCCCGCGCTCCGGAAGATG
AGCAGTTAATGGATATTTTTGAAAAGCTGCGCGATCTTGATAAGCAGCGTGAAAATCAGCGGCAAAAATA
TCTTTCATTGCTGGAAGACGCTAAACGGGTTAAGCAACAGCAACTGGATTGTGTCCGTCAGGTGCAAAAA
CTGCATGATGCGGCCCGCAGTCAGCATGGCTTTAGTAGCGCCTTCAAAAATGCGCAGGAAACAATTAATT
TACTCGATCGGTATAGCGACGTATTAACTCAGGCGAGAGTAAAGACGCTATCTGCTAACTTTGAAGTTGC
CTATCGCAAACTGGCTCGTAAAGAAGATATGCAACTGAGTGCTCATATTAACCCAGAGACATTTGACGTT
GAGTTAATTGATGAGAAGGGATCTGTCATTAATCGTAAGTTACTATCTGCCGGTGAAAAGCAGATTTATG
CCATTGCTATTCTTGAGGCGCTAGCAAAAACTTCTGGTCGTGATTTGCCGGTGATTATTGATACGCCATT
AGGACGTCTGGATTCACAACATCGGGATAAACTAATTAACCATTATTTCCCATTTGCCAGCCATCAAGTG
GTGCTATTGTCTACCGATACGGAAGTGGATGAACGTTATTTTGTTGACCAATTACGTGATGATATTTCTC
ATGCTTACGAGATAGTATTTAACACGCATACTAAATCATCAGCGTTGAAGCCCGGTTATTTCTGGGAATT
AACTAAGGAGGCTATCTGA