Summary Sequence Context  
1 homologue found:

HomologuedndE
OrganismEscherichia coli 55989
GID1122
PID2122
Locus tagEC55989_4838
Locations4958859..4959215
Length357 bp
G+C%44
Link NCBI: gi:218693476  
SequenceATGCTCCCGAATCGAATGGTGCTGAATCGTCAGACTGAAGAGCAGCTTAAAAGATTGAAAGGGTATACAG
GGATCACACCTAATGTCGCTGCCCGATTGGCATTTTTCCGCTCGGTGGAGAGTGAGTTTCGCTATTCATC
AGAACGGGATAATCGGAAACTAGATGGTTCGCTGGTGTTGGATAAGATTACGTGGCTGGGGGAGACATTA
CAGACTACGGAATTGGTATTGAAGATGCTTTATCCGCAGTTAGCTCAGAAGGATATGGTTAAAGCATGGG
CTGCGCATGTGGAGGATGGGATTGCGGCGTTAAGGAATCATAAGAGTCTATTAAACTTTATTAAATCAAT
AGATTAA