Summary Sequence Alignment 16S rRNA Context  
5 homologues found:

HomologuedndE
Organismgamma proteobacterium NOR5-3
GID1140
PID2140
Locus tagnot annotated in Gen
Locations277534..277897
Length364 bp
G+C%45
Link NCBI: gi:219674692   
SequenceATGATCGCAACTGTAAGAGTCACTGAGAAAGGAAAGAACTCTCTCATCCAGCTCAAAAGAAAAACCGGAA
TCGAAAATTGGAACACCTTGTGTCGCTGGGCACTAGTAACGTCCTTAGCCGAATCTTCTGTTCCACCAAA
AGAAGAAGCAGGCCAACTCAGCAATATCGAAATGAGCTGGAAAACGTTTGGCGGAGACTATGCTGACATT
TACGAGGCAGCTTTCAAGCAGCGCTTACACGAAGACCAATTGCCAGTTAGCGAAGCAAACCAATGGTTTA
TAGTTCATCTACACCGAGGTATTTCGTATCTGAATAGAAAAACCAGTAACGCAAGTGACCTTCTAGCGCT
GCTTGGGGAATGA

HomologuedndA
Organismgamma proteobacterium NOR5-3
GID1127
PID2127
Locus tagNOR53_2472
Locations271670..272848
Length1179 bp
G+C%53
Link NCBI: gi:219674692  
SequenceATGCGAACAAAACATGCAACCTCAATCTTGCGCGTGAGCAGTAAATTTATGGATCAGTACCTCGATACAA
ACGCGACGGCGCCTATCGAACCCGAGGTCGCAGAGATCGTTATTCATTACCTAACGCAGGAGTTTGGGAA
TGCCGGGTCGCGCACCCATGAATATGGTTCGCGTGCGAAGAAGGCGGTTGAACTTGCCCGAAGCCAGATT
GCAAAGGTAATCGACTGTGATAGGAGCGAGGTGATATTCACTAGTGGGGCAACGGAAAGCAACAATTTGG
TGATATTGGGATTAAGGGCGTTTTTAGAGGAATCGAGTAAGCGGCATTTGATTACGGCTGCCACAGAGCA
CAAAGCTGTACTAGAACCTATGCAGCATCTGGAAGCGGGCGGATTCGAGCTTACAGTGCTGCCGCCGGGA
CCTGGGGGGTATGTTTTGCCCAGCGATCTCGAACGCGCGCTGCGCCCTGATACGGGGCTGGTATCGCTGA
TGCAAGTGAACAACGAAACAGGAGTTGAGCAGCCGTTATCAGAATACGCGGCAGTATTGGCTGAACATGA
CTGCTATTTCCATACGGATGCTGCTCAGGGCTTTGGAAAATCTATTAGCCCATTAACAAATTCTCGCGTG
GACCTGATCAGCGTATCTGGACACAAGATATATGCGCCGAAAGGCGTGGGCGCTTTGGTAGCGAGGCGGC
GACGCTACAAGATGCCTCCGTTGAAGCCTCTTATGTACGGGGGTGGTCAAGAACGGGGGTTAAGACCTGG
TACGGCTCCTGTCGCTCTAATTGCGGGGCTAGGCAAAGCGTCTGAGCTGGCACTTGAGCACCACGCAAGA
CGAGCTCAAGTTAATCTAAGGATTAGGCAAGACGCCTTGGCTGCGCTCAGTGACTTAGGACCCGTAATGC
ATGGTGACCAGACACGGGTTTTATCTCATGTGCTCAGTTTTTCAGTGCCGGGCGTCAACTCTGAAGCAGC
CCTGATTGGATTGAAGGGTATTGCTGCGGTTTCAAATGGCTCTGCCTGCACCTCGGCGAGTTATGAGGGG
AGTCATGTGCTTAAAGCCATGGGTCTTACTGAGGATGAGGTATTCGGAGCGCTAAGAGTTTCATGGAGTC
ACTTAGGTGCGCCCCCTGACTGGTCGGATTTCGCAGCGGCACTTGCGACATTGCAATAA

HomologuedndB
Organismgamma proteobacterium NOR5-3
GID1128
PID2128
Locus tagNOR53_2874
Locations272908..274002
Length1095 bp
G+C%49
Link NCBI: gi:219674692  
SequenceATGACTGCAGAGTTCGAATATGTATTCCCAGCAATCAGAGGTGTGCAAGCGCAACGTGAATACTACGTGT
CAATGTGCCCCCTCCGCCTCATCCCAAAACTGTTTACATTTGACGAGGAGGAGCTGCCACCGGATATGAG
AGCCCAGCGGAAGTTGAACCTCACCCGCATACCAGCCATATCACGGTATCTTATTGAAAATAAAGATAAT
TATGTTTTCTCGTCTATCACGGCATCTGTAAACGGCCCCGTGATTTTTGAGCCTATCGGGGACCAGGATG
CACACAACCGCGTAGGCTCCTTGCGCATTGATATGAATGCGCAGTTTATTATCAACGATGGCCAGCACAG
ACGCGGGGCAATTGAGGCTGCGCTCAAAGAAGAGCCCAGCCTGGGCGATGAGACGATTTCTGTAGTCTTC
TTTATCGACCGAGGACTCGAGAGATGCCAACAAATGTTTGTGGATTTAAACAAACACGCCATCAAGCCGA
GCGCATCACTCAATACCCTGTACGACCAGCGAGAGGATATTTCGAAAATTGCAAAGGCCATTGCTCTGGA
ATCGACAACGTTTAAAGGCGTCGTCGAAATGGAGAAGTCAACTTTGGCTCGTCGCTCTCGAAAGCTGGTC
ACATTGAGCGCAATCAAGACAGCTACCGCTTGCCTGCTTGCTGGCAAGGAGCTCAAGAACATCGACGACG
CAACGTCTTTTAGTATTAAGTACTGGGACGAACTTGGTAAGCATATTTCTGAGTGGCAACTTGTTTCGCA
GGGGCGAATTACGGCCGGGGAGATTCGTGAGGGCTACGTAAATTGCCATGCAATCGTGCTTCAAGTTCTC
GGAATAATAGGAAATAAGCTCTGTGACTTGTCCTGGAAGGAGTCCAAAGAGCGACTCAAGCTGCTGGAGC
AGATTGATTGGAGCAGGTCAAACGCAAAGGTATGGGAAGGAAGAGCGATGATAGGGGGTCGAATGTCCAA
GTCCTCAAATAACATCACGCTTACTTCAAACTACATTAAATCTCAGATTGGATTGGATTTGAGCCCCGAG
GAGCAACGAGTGGAGGACGCATATCTGCGTGGTGAAAATGTCTGA

HomologuedndC
Organismgamma proteobacterium NOR5-3
GID1129
PID2129
Locus tagNOR53_2490
Locations273995..275560
Length1566 bp
G+C%48
Link NCBI: gi:219674692  
SequenceATGTCTGAATCACCTAAAAAGCAACGTAAGACAGCTTTTCGAGAACTCGGCATCAAGCAACATGTTGAAA
ACCTGGAAGAACAAACCCGCCAACTTTACCTAAGTGATGAAATCCCATGGGTCATTGGATACAGCGGCGG
CAAAGACTCAACGGCAACCCTACAGCTGATATGGAGTGCTCTGAGCAAGCTTTCGCCAAAAGATCACATT
AAGCCGGTTCACGTGATCAGCACAGACACACTAGTTGAAAACCCGGTAGTGGCACTATGGGTTGAGAAGT
CTTTATCAAAAATGCGTGCGGCGAGCGGCGAGCAAAGCATGCCCATAAAACCACACCGACTAACGCCTGA
GGTTAAAGACCGCTTTTGGGTAAATCTTATTGGGCGCGGCTACCCCGCGCCACGTCCCAAGTTTAGATGG
TGTACTGAACGGCTGAAGATCTCTCCGTCAAACAAGTTTATCTCGGAAACCGTACAGCAAAACGGAGAGG
CCATATTAGTCCTCGGCACACGCAAGTCCGAAAGCGCCGCCCGAGCGTCGAACATGAAGCAGTACGAGTC
AAAAAGTACTCGAGACCTCCTAAGCAGCAACAAAGAGCTCGATCGTGTCTGGGTCTACACGCCTATCGCA
GAATGGCAAAACGACGATGTGTGGCAATACCTTACACAATTCGAAAACCCCTGGGGATTCCCAAACGAAG
ACCTCTTTGGAATGTACCAAGGTGCTACCGAAGATGGCGAATGCCCACTAGTCGTCGACACCAGTACGCC
CAGTTGTGGCGACAGCCGATTTGGTTGTCACGTTTGCACAATGGTAAACGAAGACAAATCTCTTTCGGCG
ATGATTCAAAACGACGTCGAGAAAGAATGGATGCTTCCCCTACTCGAATTCAGATCCAACTGGATCAACA
TTAACGATGCTGATCCAGAAAAGAAAAAACAGAAAATTGACGAAGAACGAAAGCATCGTGACTTCCGCCG
GATGAATGGTTCTCTTACCGTCTTCAATGGCCGCCTAGTTCATGGACCTTACAAAGCCTATTACCGCGAA
AACATGCTGAGGGCGGTACTCGAAGCACAAATGGCTGTACGAGAGATTGGTCCGGACTCTGTCAAAGATC
TCGAGGTGATCTCTCTCGAGGAACTCGAAGAGATAAGGCGGATTTGGGTGGTTGAAAAACACGAAATCGA
AGACCGACTCCCAGTCGTCTATGAAGAGGCTACCGGACAGAAATATCCGGCGCGCAGAAACATGTCTGAT
CTCGGTCTATCTCAGGAAGACCTCACTTTACTGAAAGAGATTTGCCAGGAAGTAGACGATTCCGAGATTC
ACTATGAGGTAGTGAGAGCGCTACTCCATATTGAGCATCAGAATCGGACGATGGTGAAACGAAACAAAGG
GTTCTTCAAGAACTTGGAAAAGGTACTGGAGTCGGGCGTTTTCTCAAACGAAGCGGATGCCCAAGACTAT
GCCGTAAGCAAGCAAAGCAAGAAGGATGACATCATCGCCAGTGCATCAGACGAGTTCTCGCAATCCGATT
ACATACAACTAAAAGAAATCAGCTAG

HomologuedndD
Organismgamma proteobacterium NOR5-3
GID1130
PID2130
Locus tagNOR53_2579
Locations275572..277530
Length1959 bp
G+C%48
Link NCBI: gi:219674692  
SequenceTTGTTATTTACCGAACTCGTCATTCACAACTTTGGCATTTACCGCGGAAGGCATACGGTAGATCTGAGGC
CAAAGTCCTTGGGACAGCCCATCATACTTTTTGGAGGCCTCAATGGGGGCGGTAAAACGACGTTCTTAGA
CGCTATGAAACTAGTCCTCTATGGAAAGTTTGCAGAGTGCTCCAACAGAGGCTCACAGTCTTATGATCAA
TACTTAGCCAACACCATCAACCGACACTGCCCGCCCAATGAGGGAGCCGCGATCGAGCTTGAGTTCACTA
TCTATAGGGCGTCAGAGGAAACTACGATACGAGTCAAGCGGTTCTGGCAAAAAATGAAGACGGTGTCGGA
GAAGGTAGAGGTTCTGGAAAATGACGCGCACAACCCATTCTTAAGTGAGCATTGGTTGGACCATGTAGAC
GAGTTCATACCTCAGGAAATTGCCAACTTATTCTTTTTTGACGGCGAAAAAATTGAGGCATTGGCCGACA
AGAAACGCTCAGGATCTATTGTGAAGACGGGCATTGATTCACTGCTTGGGCTAAACCAGGTTAGCAAGCT
GGAGTCGGATTTGGATGTACTCGACCGAAGAAGGACAACTACGACCGCGGACGTAAAGTTAAAAAGAGAT
ATCGAGGAGTGCCAATCTAAGCTAGCCCACCTAACGACCGAACGCCAGGATACAACCAATCGAATCGGAA
CGTTAGGGAGCGAGATCGAGCAACTCGAGAACCGACTAAGAGATCAACGCAAAAAGCTGCGCGATCTTGG
AGGACACCTGCTGGAAAACAGAGAACGCAACGAGCAAGACCTCGAGAAAGTTGAGGCTAGTCTGGCAGAG
AGTCGACTATCAATGCGTGAGCTGGCTTCTGGCGTCGCACCTATACTGCTCATTGAAAAGATAGTCTCTC
GCGCGAAGGACCAAAGTGAGCGGGAAGCGCAGAGCAAGCGCAGCAAGGAGTTCCTGAAGCAGGCGCAGGA
CCGCGATAAGGCGCTTCTGGACTTCTTAGATCAAACCAACGCAAACGCTGTTTCCGAGTCAATACGGGAC
TGGCTAGCGAATGATATCGAGCTGCGATCACCATCAAACGAAGAGCCAAGCTACCTTGACACCGAATCTG
CCATCTTCGAAAAGCTGGAGGGAGATGTAACTGGATTTGTGAGAAAGCGGGCTAAAGAGTTGGTCGAAGC
TACAAGTCGTTTGGAAGCGGAAAAAGAACACTTACAACAACAACTAGCGGCCATGCCGAACGAAAAGAAA
GCTCACAGCGTAATTATCGAAATTAAGAATCTCGAGGCCCAACTCACACAGAATACTGCGAAGCTTGCTG
TCCAGAAAGAAGGCCACCAGACCGCCAAAAAGCAAATCGAAAAAATAGAAGAGCGCGAATTCAAGCTTAA
TACTGCATTGATTGAAGCAAAGTACGCAGATCAAAAAATAGAGCTTATGAACAAGAGAAGCAAGCTAGTT
AAGCAAACACTAAGGAGCTACAAGTCTAAAATACTAAGTGCTCACATCTCCAAACTTGAGACTCTAATCT
TCGATAGCTTCACCTCCTTAGTGAGAAAGCACGCTCTAATAAGTTGCGTCAAAATTGATCCAGACACTTT
CGAAATAACCGTGTTCGATTCTGACAATGTCGCGCTACCTACAGATAGACTTAGTGCAGGAGAACGTCAG
CTCTTCGCTATTGCGATTCTCTGGGGCCTTGCTAAAGCTTCGGGACGACCACTCCCATCCATCGTAGACA
CACCACTGGGCCGGCTTGACAGCCAGCACAGAACACACCTCGTCGAGAACTATTTCCCTTACGCGAGTCA
TCAAGTGATTTTGCTATCTACCGACGAAGAAATAGATCAGCGGTACCGCGACAAGCTGTCAAAGTTTATC
GGGAAGGAATATCACATTAGCTATTCGCAAGAAGCAAAGACTTCAACAATAACGCCTGGGTATTTTTAA