Summary Sequence Context  
1 homologue found:

HomologuedndA
Organismgamma proteobacterium NOR5-3
GID1127
PID2127
Locus tagNOR53_2472
Locations271670..272848
Length1179 bp
G+C%53
Link NCBI: gi:219674692  
SequenceATGCGAACAAAACATGCAACCTCAATCTTGCGCGTGAGCAGTAAATTTATGGATCAGTACCTCGATACAA
ACGCGACGGCGCCTATCGAACCCGAGGTCGCAGAGATCGTTATTCATTACCTAACGCAGGAGTTTGGGAA
TGCCGGGTCGCGCACCCATGAATATGGTTCGCGTGCGAAGAAGGCGGTTGAACTTGCCCGAAGCCAGATT
GCAAAGGTAATCGACTGTGATAGGAGCGAGGTGATATTCACTAGTGGGGCAACGGAAAGCAACAATTTGG
TGATATTGGGATTAAGGGCGTTTTTAGAGGAATCGAGTAAGCGGCATTTGATTACGGCTGCCACAGAGCA
CAAAGCTGTACTAGAACCTATGCAGCATCTGGAAGCGGGCGGATTCGAGCTTACAGTGCTGCCGCCGGGA
CCTGGGGGGTATGTTTTGCCCAGCGATCTCGAACGCGCGCTGCGCCCTGATACGGGGCTGGTATCGCTGA
TGCAAGTGAACAACGAAACAGGAGTTGAGCAGCCGTTATCAGAATACGCGGCAGTATTGGCTGAACATGA
CTGCTATTTCCATACGGATGCTGCTCAGGGCTTTGGAAAATCTATTAGCCCATTAACAAATTCTCGCGTG
GACCTGATCAGCGTATCTGGACACAAGATATATGCGCCGAAAGGCGTGGGCGCTTTGGTAGCGAGGCGGC
GACGCTACAAGATGCCTCCGTTGAAGCCTCTTATGTACGGGGGTGGTCAAGAACGGGGGTTAAGACCTGG
TACGGCTCCTGTCGCTCTAATTGCGGGGCTAGGCAAAGCGTCTGAGCTGGCACTTGAGCACCACGCAAGA
CGAGCTCAAGTTAATCTAAGGATTAGGCAAGACGCCTTGGCTGCGCTCAGTGACTTAGGACCCGTAATGC
ATGGTGACCAGACACGGGTTTTATCTCATGTGCTCAGTTTTTCAGTGCCGGGCGTCAACTCTGAAGCAGC
CCTGATTGGATTGAAGGGTATTGCTGCGGTTTCAAATGGCTCTGCCTGCACCTCGGCGAGTTATGAGGGG
AGTCATGTGCTTAAAGCCATGGGTCTTACTGAGGATGAGGTATTCGGAGCGCTAAGAGTTTCATGGAGTC
ACTTAGGTGCGCCCCCTGACTGGTCGGATTTCGCAGCGGCACTTGCGACATTGCAATAA