Summary Sequence Context  
1 homologue found:

HomologuedndB
Organismgamma proteobacterium NOR5-3
GID1128
PID2128
Locus tagNOR53_2874
Locations272908..274002
Length1095 bp
G+C%49
Link NCBI: gi:219674692  
SequenceATGACTGCAGAGTTCGAATATGTATTCCCAGCAATCAGAGGTGTGCAAGCGCAACGTGAATACTACGTGT
CAATGTGCCCCCTCCGCCTCATCCCAAAACTGTTTACATTTGACGAGGAGGAGCTGCCACCGGATATGAG
AGCCCAGCGGAAGTTGAACCTCACCCGCATACCAGCCATATCACGGTATCTTATTGAAAATAAAGATAAT
TATGTTTTCTCGTCTATCACGGCATCTGTAAACGGCCCCGTGATTTTTGAGCCTATCGGGGACCAGGATG
CACACAACCGCGTAGGCTCCTTGCGCATTGATATGAATGCGCAGTTTATTATCAACGATGGCCAGCACAG
ACGCGGGGCAATTGAGGCTGCGCTCAAAGAAGAGCCCAGCCTGGGCGATGAGACGATTTCTGTAGTCTTC
TTTATCGACCGAGGACTCGAGAGATGCCAACAAATGTTTGTGGATTTAAACAAACACGCCATCAAGCCGA
GCGCATCACTCAATACCCTGTACGACCAGCGAGAGGATATTTCGAAAATTGCAAAGGCCATTGCTCTGGA
ATCGACAACGTTTAAAGGCGTCGTCGAAATGGAGAAGTCAACTTTGGCTCGTCGCTCTCGAAAGCTGGTC
ACATTGAGCGCAATCAAGACAGCTACCGCTTGCCTGCTTGCTGGCAAGGAGCTCAAGAACATCGACGACG
CAACGTCTTTTAGTATTAAGTACTGGGACGAACTTGGTAAGCATATTTCTGAGTGGCAACTTGTTTCGCA
GGGGCGAATTACGGCCGGGGAGATTCGTGAGGGCTACGTAAATTGCCATGCAATCGTGCTTCAAGTTCTC
GGAATAATAGGAAATAAGCTCTGTGACTTGTCCTGGAAGGAGTCCAAAGAGCGACTCAAGCTGCTGGAGC
AGATTGATTGGAGCAGGTCAAACGCAAAGGTATGGGAAGGAAGAGCGATGATAGGGGGTCGAATGTCCAA
GTCCTCAAATAACATCACGCTTACTTCAAACTACATTAAATCTCAGATTGGATTGGATTTGAGCCCCGAG
GAGCAACGAGTGGAGGACGCATATCTGCGTGGTGAAAATGTCTGA