Summary Sequence Context  
1 homologue found:

HomologuedndC
Organismgamma proteobacterium NOR5-3
GID1129
PID2129
Locus tagNOR53_2490
Locations273995..275560
Length1566 bp
G+C%48
Link NCBI: gi:219674692  
SequenceATGTCTGAATCACCTAAAAAGCAACGTAAGACAGCTTTTCGAGAACTCGGCATCAAGCAACATGTTGAAA
ACCTGGAAGAACAAACCCGCCAACTTTACCTAAGTGATGAAATCCCATGGGTCATTGGATACAGCGGCGG
CAAAGACTCAACGGCAACCCTACAGCTGATATGGAGTGCTCTGAGCAAGCTTTCGCCAAAAGATCACATT
AAGCCGGTTCACGTGATCAGCACAGACACACTAGTTGAAAACCCGGTAGTGGCACTATGGGTTGAGAAGT
CTTTATCAAAAATGCGTGCGGCGAGCGGCGAGCAAAGCATGCCCATAAAACCACACCGACTAACGCCTGA
GGTTAAAGACCGCTTTTGGGTAAATCTTATTGGGCGCGGCTACCCCGCGCCACGTCCCAAGTTTAGATGG
TGTACTGAACGGCTGAAGATCTCTCCGTCAAACAAGTTTATCTCGGAAACCGTACAGCAAAACGGAGAGG
CCATATTAGTCCTCGGCACACGCAAGTCCGAAAGCGCCGCCCGAGCGTCGAACATGAAGCAGTACGAGTC
AAAAAGTACTCGAGACCTCCTAAGCAGCAACAAAGAGCTCGATCGTGTCTGGGTCTACACGCCTATCGCA
GAATGGCAAAACGACGATGTGTGGCAATACCTTACACAATTCGAAAACCCCTGGGGATTCCCAAACGAAG
ACCTCTTTGGAATGTACCAAGGTGCTACCGAAGATGGCGAATGCCCACTAGTCGTCGACACCAGTACGCC
CAGTTGTGGCGACAGCCGATTTGGTTGTCACGTTTGCACAATGGTAAACGAAGACAAATCTCTTTCGGCG
ATGATTCAAAACGACGTCGAGAAAGAATGGATGCTTCCCCTACTCGAATTCAGATCCAACTGGATCAACA
TTAACGATGCTGATCCAGAAAAGAAAAAACAGAAAATTGACGAAGAACGAAAGCATCGTGACTTCCGCCG
GATGAATGGTTCTCTTACCGTCTTCAATGGCCGCCTAGTTCATGGACCTTACAAAGCCTATTACCGCGAA
AACATGCTGAGGGCGGTACTCGAAGCACAAATGGCTGTACGAGAGATTGGTCCGGACTCTGTCAAAGATC
TCGAGGTGATCTCTCTCGAGGAACTCGAAGAGATAAGGCGGATTTGGGTGGTTGAAAAACACGAAATCGA
AGACCGACTCCCAGTCGTCTATGAAGAGGCTACCGGACAGAAATATCCGGCGCGCAGAAACATGTCTGAT
CTCGGTCTATCTCAGGAAGACCTCACTTTACTGAAAGAGATTTGCCAGGAAGTAGACGATTCCGAGATTC
ACTATGAGGTAGTGAGAGCGCTACTCCATATTGAGCATCAGAATCGGACGATGGTGAAACGAAACAAAGG
GTTCTTCAAGAACTTGGAAAAGGTACTGGAGTCGGGCGTTTTCTCAAACGAAGCGGATGCCCAAGACTAT
GCCGTAAGCAAGCAAAGCAAGAAGGATGACATCATCGCCAGTGCATCAGACGAGTTCTCGCAATCCGATT
ACATACAACTAAAAGAAATCAGCTAG