Summary Sequence Context  
1 homologue found:

HomologuedndD
Organismgamma proteobacterium NOR5-3
GID1130
PID2130
Locus tagNOR53_2579
Locations275572..277530
Length1959 bp
G+C%48
Link NCBI: gi:219674692  
SequenceTTGTTATTTACCGAACTCGTCATTCACAACTTTGGCATTTACCGCGGAAGGCATACGGTAGATCTGAGGC
CAAAGTCCTTGGGACAGCCCATCATACTTTTTGGAGGCCTCAATGGGGGCGGTAAAACGACGTTCTTAGA
CGCTATGAAACTAGTCCTCTATGGAAAGTTTGCAGAGTGCTCCAACAGAGGCTCACAGTCTTATGATCAA
TACTTAGCCAACACCATCAACCGACACTGCCCGCCCAATGAGGGAGCCGCGATCGAGCTTGAGTTCACTA
TCTATAGGGCGTCAGAGGAAACTACGATACGAGTCAAGCGGTTCTGGCAAAAAATGAAGACGGTGTCGGA
GAAGGTAGAGGTTCTGGAAAATGACGCGCACAACCCATTCTTAAGTGAGCATTGGTTGGACCATGTAGAC
GAGTTCATACCTCAGGAAATTGCCAACTTATTCTTTTTTGACGGCGAAAAAATTGAGGCATTGGCCGACA
AGAAACGCTCAGGATCTATTGTGAAGACGGGCATTGATTCACTGCTTGGGCTAAACCAGGTTAGCAAGCT
GGAGTCGGATTTGGATGTACTCGACCGAAGAAGGACAACTACGACCGCGGACGTAAAGTTAAAAAGAGAT
ATCGAGGAGTGCCAATCTAAGCTAGCCCACCTAACGACCGAACGCCAGGATACAACCAATCGAATCGGAA
CGTTAGGGAGCGAGATCGAGCAACTCGAGAACCGACTAAGAGATCAACGCAAAAAGCTGCGCGATCTTGG
AGGACACCTGCTGGAAAACAGAGAACGCAACGAGCAAGACCTCGAGAAAGTTGAGGCTAGTCTGGCAGAG
AGTCGACTATCAATGCGTGAGCTGGCTTCTGGCGTCGCACCTATACTGCTCATTGAAAAGATAGTCTCTC
GCGCGAAGGACCAAAGTGAGCGGGAAGCGCAGAGCAAGCGCAGCAAGGAGTTCCTGAAGCAGGCGCAGGA
CCGCGATAAGGCGCTTCTGGACTTCTTAGATCAAACCAACGCAAACGCTGTTTCCGAGTCAATACGGGAC
TGGCTAGCGAATGATATCGAGCTGCGATCACCATCAAACGAAGAGCCAAGCTACCTTGACACCGAATCTG
CCATCTTCGAAAAGCTGGAGGGAGATGTAACTGGATTTGTGAGAAAGCGGGCTAAAGAGTTGGTCGAAGC
TACAAGTCGTTTGGAAGCGGAAAAAGAACACTTACAACAACAACTAGCGGCCATGCCGAACGAAAAGAAA
GCTCACAGCGTAATTATCGAAATTAAGAATCTCGAGGCCCAACTCACACAGAATACTGCGAAGCTTGCTG
TCCAGAAAGAAGGCCACCAGACCGCCAAAAAGCAAATCGAAAAAATAGAAGAGCGCGAATTCAAGCTTAA
TACTGCATTGATTGAAGCAAAGTACGCAGATCAAAAAATAGAGCTTATGAACAAGAGAAGCAAGCTAGTT
AAGCAAACACTAAGGAGCTACAAGTCTAAAATACTAAGTGCTCACATCTCCAAACTTGAGACTCTAATCT
TCGATAGCTTCACCTCCTTAGTGAGAAAGCACGCTCTAATAAGTTGCGTCAAAATTGATCCAGACACTTT
CGAAATAACCGTGTTCGATTCTGACAATGTCGCGCTACCTACAGATAGACTTAGTGCAGGAGAACGTCAG
CTCTTCGCTATTGCGATTCTCTGGGGCCTTGCTAAAGCTTCGGGACGACCACTCCCATCCATCGTAGACA
CACCACTGGGCCGGCTTGACAGCCAGCACAGAACACACCTCGTCGAGAACTATTTCCCTTACGCGAGTCA
TCAAGTGATTTTGCTATCTACCGACGAAGAAATAGATCAGCGGTACCGCGACAAGCTGTCAAAGTTTATC
GGGAAGGAATATCACATTAGCTATTCGCAAGAAGCAAAGACTTCAACAATAACGCCTGGGTATTTTTAA