Summary Sequence Context  
1 homologue found:

HomologuedndE
Organismgamma proteobacterium NOR5-3
GID1140
PID2140
Locus tagnot annotated in Gen
Locations277534..277897
Length364 bp
G+C%45
Link NCBI: gi:219674692   
SequenceATGATCGCAACTGTAAGAGTCACTGAGAAAGGAAAGAACTCTCTCATCCAGCTCAAAAGAAAAACCGGAA
TCGAAAATTGGAACACCTTGTGTCGCTGGGCACTAGTAACGTCCTTAGCCGAATCTTCTGTTCCACCAAA
AGAAGAAGCAGGCCAACTCAGCAATATCGAAATGAGCTGGAAAACGTTTGGCGGAGACTATGCTGACATT
TACGAGGCAGCTTTCAAGCAGCGCTTACACGAAGACCAATTGCCAGTTAGCGAAGCAAACCAATGGTTTA
TAGTTCATCTACACCGAGGTATTTCGTATCTGAATAGAAAAACCAGTAACGCAAGTGACCTTCTAGCGCT
GCTTGGGGAATGA