Summary Sequence Alignment 16S rRNA Context  
5 homologues found:

HomologuedndA
OrganismAcidobacterium capsulatum ATCC 51196
GID1131
PID2131
Locus tagACP_3187
Locations3684560..3685696
Length1137 bp
G+C%54
Link NCBI: gi:225871699  
SequenceATGCCGCCAATTTACCTTGACTGCAATGCATCAACGCCCATCGACCCTGCGGTTTTTGACGCCATGCGGC
CCTGGCTCGTCAACGATTTTGGAAATTCGAGCAGTAGAACACACGAATTCGGCCTCAAGGCAAAGCGCGC
GGTTGCGCTTGCGAGGAAGCAGATCGCCAGTGCCTTCGGAGTTGATCAAGAAGAAGTTGTATTCACTAGT
GGCGCGACAGAAAGCAACAACCTTGCGATTCTCGGGCTGGCGAGTTGGGGCGAGCAGACTGGCCGCAAGC
ATCTCATCACTTCCGCGATGGAGCACAGTGCTGTTCTTGAGCCTATCGCTTGGCTTCGAGATAACGCCGG
TTTTTCCGTCACGGAGCTTCCCGCTTCATCGGACGGCATCATAGACCCAGACGACCTTAGGCGGTCACTC
CGGCCCGATACCGCTCTCGTATCCCTGATGCAGGTGAACAATGAGACGGGTGTGATCCAACCCCTCCGTG
AACTCGCAATAGTACTTACAGATCACCCTGCATACTTCCACGTCGATGCTGCTCAAGGATTTGGCAAAGA
ATTCACAGAAATCTCGGCGAGAAGGATCGACCTTATCTCTTGCACCGGTCACAAGATCTATGGGCCTCAA
GGCATTGGCGCACTCGTTGTAAAGCGCACTCACGAGCGGCCCATTCCTCTGAAACCTCTTACGTTTGGCG
GTGGACACGAACGTGGACTCAGGCCAGGCACCCTTCCTACCCACCTGATTGTTGGATTCGGTAGTGCTGC
ATCCTTGGCTGTTGCCGACCACAAAGCCCGTGAGAGCAAGAATCGCAGTTTCCGGAAGCAATTGTTCGAG
GGGCTCGACGGATTGCCTTTGACTACTCACGGAGCCCCAAATTTGGTAATTCCGCACGTAACGAACCTCA
GCATCGATGGGGTCTCTTCTGAAGCAGCTATGGTAGCGCTTAGGCAGTACATCGCGATTTCAAATGGTTC
AGCCTGCTCATCGGCGAAGTATGAGCCGAGCCACGTCTTGCGAGCCATGGGACTTTCTAATGAGCAATTG
GATGGAGCAATGCGGTTTTCTTGGTGCCACCTCACACCTGAGGTTGATTGGCGCGCCGTTCGGGCACTAC
TTGCGGAATTTCTTTAG

HomologuedndB
OrganismAcidobacterium capsulatum ATCC 51196
GID1132
PID2132
Locus tagACP_3186
Locations3683415..3684494
Length1080 bp
G+C%51
Link NCBI: gi:225871699  
SequenceATGGATGTGGCATTCGAGTACCGGTTCCCCGCGATTCGCGGGATTCAATCGAACCGGGAGTACTACATCT
CAATGTGCCCCTTACGATTGATTCCAAAGCTATTTATCTTCGATGAGGCAGAGCTGCGTCCTGAGCTTCG
CGCCCAGAGAACCCTCAACCGCGCACGGATACCGGAAATATCCGACTACATCGTCAAGAACAGAGACTCG
TACACGTTTTCTGCCATTACGGCATCTGTAGACGGCGGCATTCAGTTCGAGCCGATGAGCCAAGACGTGT
CTATGACAAGACTGGGCCTTTTGCGTGTCGAGATGAATGCGAAGTTCATCATCAACGATGGGCAGCATCG
CCGAGCCGCGATTGAAAATGCGCTGAAAGCAGATCCTAGTCTCGGAGACGAGAGCATTGCCGTCGTGTTT
TTTCATGACCGTGGATTGGCTCGAAGCCAGCAGATGTTCGCAGATCTAAACATGCATGCGGCACGCCCTT
CGCGTTCATTAGGTCTTCTCTATGAACAGCGGGACGACTTGGCTCTGATAACGAAAGAAGCGATTCCTCG
TACGAAGATCTTTCGAGATATGGTCGAGTTTGAGCGTTCCACGCTTGCGGAGCGTTCACGAAAACTTTTT
ACGCTTAGTGCCATTTACGGAGCGAACAAAGTCCTTACGGAGAATAGGCCGTTTGAAAACCGAACTGAAG
TGCTGCAGTTCCTTATCGATTTTTGGGACACTGTTGGCTCCCATATGAAGGAATGGCAGTTGATTCAACA
AGGCCGCCAAACTTCAGGTGAACTGCGTAGGGATTTCATTCATGCGCATTCTATCGCTCTACATGCCCTG
GGCATTGTGGGACGGGACTTGGTTCAGCAGTTCCCGAAGAACTGGAAGGGAAAGCTCCGAAAATTGCGTG
ACATAGATTGGTCGCGGTCGAATACCAAAGACTGGGAGGGCCGGGCGATGTTGGCAGGGGCAATCGCGAA
GACCAATTCGAGCCAACTGCTCATGGCTAATCACATACAGAAAAAGTTAGGACTGGAGCTGACACGTACG
GTTAAGGACATGAAGGGAGCCAACAAATGA

HomologuedndC
OrganismAcidobacterium capsulatum ATCC 51196
GID1133
PID2133
Locus tagACP_3185
Locations3681880..3683418
Length1539 bp
G+C%50
Link NCBI: gi:225871699  
SequenceATGAAATCACCTCAAGTGGGCCGACAATCTGCATTCAAGGCGCAGGGCTTTCGGAAGACATTGGAACTCC
TAGCAGAGAACGTGCAGGCTCTATACCTGTCAGATGAGATTCCATGGGTTGTTGGATACAGTGGAGGGAA
AGATTCAACTGCGACGCTTCAACTAATTTGGACAGCCATTGCTGCACTGCCAGCGGAAAAACGTACAAAG
GTCATTCATGTAATCAGCACCGATACGCTCGTCGAAAACCCGATCATTGCCGGTTGGGTCAATGCGTCTT
TATTAACTATGCAACGGAGCGCGAGTGACCAAGATTTGCCGTTTCGCCCCAATCGCTTGTTGCCGGAGCT
AAAGGACCGTTTTTGGGTAAACATGATCGGGCGCGGATATCCTGCTCCTCGCCCAAAATTTCGTTGGTGT
ACTGAGCGACTAAAGATAAACCCGTCGAATAATTTTATCCGCAACGTCGTCGACGATGCGGGTGAGGTCA
TCTTGGCGTTGGGGACACGAAAGGCGGAAAGCCAGGTGCGCTCGGCTTCGATTGATCATTACTCGAAGAA
TGCGCGGGCTGGATTACAGCGGCATGGACAATTAGACCGAAGTTGGGTATTCTCGCCGATCGTCGATTGG
TCGAACGACGATGTCTGGCAATATCTGATGCAAGTAAAAAATCCTTGGGGTATCGACAATAAGGATCTGC
TGGGGATGTATCAAGGGGCAACTGAAGATGGAGAATGCCCGTTGGTCGTGGATACGAGTACTCCGAGCTG
CGGCGACAGCAGATTTGGTTGCTACGTGTGCACAATGGTGACAGAAGACAAGTCGATGCGATCAATGATC
GCCAACGACTCCGATAAAGCGTGGATGCTTCCGCTTTTGCAGTTTCGTAATCAATATCTTGGAAATCTAA
ACGATCGCAACGTGAGAGAGTTTAAGCGCTTAAATGGTTCCCTCATGGTGCACAACGATCGTTTAGTACA
CGGGCCTTACACCCAGAGCTATCGCGTGAATATGCTTCGGGCCCTATTAGAAACGCAGTTGACAGTGAAC
AAGCACTTACCCAAAGGGATCGACTCCCTCGAACTGATTACCATTGAAGAATTGCGAGAGATACGACGAA
TCTGGATTGAAGATAAGCATGAAGTTGAGGATCTCCTTCCCGCAGTCTATGAAGACACGTTGAAGCGACC
ATTCTCGGCAAACAGCGTGTCTGTGGTGCCGCTGCTCCGCACGTCGGAAATTGAGACGCTTCGCGAGATA
TCGGATGGTCAAACAGTCGAGTCGCGTTTGCACTACGAGCTTCTTCGTGAACTGATCACTACCCAAGCTG
TGTCAAAGAGCACGCACAGCCGTGCGAAGCTACTTGACGAACTGGACCGAGTCCTGGAACGAAGCGCTTT
CGCTGATGCGGACGAAGCATTGAGTGTTGCACTGAGTCGAAGAGGAATGAGTGCATCTGAAGACTCCGGA
CTCGGCGGCCAAGACATGCCTTCGCTGTTCGTCAACATCACACTGCCGGAGCAAAATGACGTTTCTTGA

HomologuedndD
OrganismAcidobacterium capsulatum ATCC 51196
GID1134
PID2134
Locus tagACP_3184
Locations3679926..3681893
Length1968 bp
G+C%51
Link NCBI: gi:225871699  
SequenceATGACGTTTCTTGAAATTGACTTAGAGAATTTGGGGCCGTTTCGGGGAAGACACGCCATAAAATTGGCGG
TGAGTTCTCCCCGCAATATTGTTCTGATTGGTGCATTGAACGGCAGCGGGAAGACTACCCTCTTAAACGC
GTTTCAATTGGCTCTATATGGACGAGACTCATTGCCTGGACGTAGTGCCAAGAACTACCAACAGTATCTC
AGGCATCTCATCAACAATCAGGCTGCATTGCATGAGAGCGCAAGCATTACCCTTACGCTGATCCTCGATG
ATCTTGCAGACGATTGTCACATACGTGTGGAACGCCGGTGGTGGCGGAGTCAGAACAATGAAGTGCGAGA
GCAACTCACGGTGTGGAAGGGGTCTGAGGCAAGTGACGATCTAACGCAGACTTGGGACACGTTCATCGCA
AGCATCCTGCCGGCTCGTGTTGCCGATCTTTTCTTCTTGGACGGCGAAAAGATTGAGGCACTGACTGCCC
CAGACCAAGCTGCTTCTATCATCAGGAAAGGCATCTTCACACTATTAGATCTTGATCGGATCGAGGAACT
CCGGGCCAATCTCCGAGTAGTCAAGCGGAGGCGTCTGAATTCCATAGAGGGCGAAGAGAACTCCGACGAA
ATTCGAGTGCTTGAAGGTAAAGTAGCTGAAAGTCTCGAAAAGCGCTCGACACTCGCACAGGAGCGCGCGT
CGCTCACGAACGTTCTTGATCGAGCTAATATGCGGGTCTTGAACGCAGAGCGAACCTTCCGTGAAGGTGG
GGGTGAGCTCTTTGAACGGCGGGAACGCTGGGTACGTCGACAGACCGAGCTACATGCAGCGTCACGACAC
ACCTCAGATCAGTTGCGGCAGATCGCTGGTCGTGAACTTCCTCTATTGGCGTGTTCTGCATTGGTCGATC
AAGGTATCGATGCTGTGAGGCGCAGCGATGAGGCACAGCGGCTTTCGATCACCATCGAGGCCATCCGAGC
GCGTGACAAAGAGTATGTTCGAATCCTGCGAGAACTTCAGTTGCCTGCTTCGATCGGCAAGGAAATTGCA
GCTGAACTCGCTCATACAGTGCCTACTATTCCATCTAACACGCCTCCAACGAGCTTCGGAATTCGAAGCG
AGCGTTTGGAGAGGTATTCCGCTGCTCAACGCAAGCGACTGAACAAAGATGTAAGTGCCCTCTTAAAGGA
ATCTGAAAAGCAAAAGAATGAACTGGCGGAGGTTGATCAAGCTATCGAAGCCGTCCCCTCTGAAGAGCAG
ATTGCCGAGCTTACGTGGGAGCTGAAAGATGCAAACGCGGAGCTCGCGCGCGTACAGGCGGCTATGGCGA
ATCTAGATGACCAGATCGAACGTTGGAATCGACAAATTGAGGATGCACGTAAGAACTTGGACTCCGCACT
TGGCACACGACTGAAACAGGGTATTTCGAATGCAGAAGCGGAACGAGTGGTACGCCATATTGAGTTGGTA
GATAGGTCCCTGCAGGAATATCTGGTCAAAATGGTTGAGAGGCATTCCGGAGACATCAGCTCGAAAATCT
TAGCCAGCTTCCGCCTAATCGCACGCAAGCCTGAACTTCTTTCTGGTTTGAAGATCGATCCGCACACTTT
CCATATGAGTCTCACAGGAAACTCTGGAAAGCATATAGATCCAGGTGAATTGTCTGCAGGAGAACGGCAG
ATTCTTGCGTTTGCGATACTCGATGGATTGGCGAAATCCTCCGGTCGTCAGATTCCGACTCTTATTGACA
GCCCATTGGGGCGTCTCGATGGCATACATCGTCAACGAATCGCGCAGCACTACTTGCCAAGCGCTTCCCA
CCAAACGATTGTTTTCTCGACCGACAAAGAAGTCGACGAACAGATGCTCAGGATGCTCAACCACAACATA
GCAGCAAGTTATTTGCTGAATTTCAACGAGAAGGCTTATGGCACAGAAATCAAAAACGGATACTTTCAAG
CCGGGTGA

HomologuedndE
OrganismAcidobacterium capsulatum ATCC 51196
GID1135
PID2135
Locus tagACP_3183
Locations3679544..3679966
Length423 bp
G+C%50
Link NCBI: gi:225871699  
SequenceATGGCACAGAAATCAAAAACGGATACTTTCAAGCCGGGTGACCCGTTTCCCATCGATACGATACGAGTAT
CTGAGCGTGCAAAACAGCAACTGATTACGCTCAAGAGAAATACCGGGATCGAACACTGGAACGTGCTGTG
CCGGTGGGCCCTATGTGTTTCCCTTCAAGAACCCTCGAAGCCTCCTATAGAGGGCGAAAGCGCACTGAGC
TCTCTTGAAATGCATTGGAAGACTTTCGCTGGTCATGAAGAAGATGCATACAAGGCAGTCTTGTTGGCCC
GTGTTATCAAAGATTTTGGGACCGTGTCGCCATCGCTGATTAGCACGCAATTCCGGCTGCACCTTCACAG
AGGAATTTCTCGATTAGCTGGCAAGAAGATCCGATCAATCGAGGACTTGGTAAGAGTCGCGGTAGACGCG
TAG