Summary Sequence Context  
1 homologue found:

HomologuedndA
OrganismAcidobacterium capsulatum ATCC 51196
GID1131
PID2131
Locus tagACP_3187
Locations3684560..3685696
Length1137 bp
G+C%54
Link NCBI: gi:225871699  
SequenceATGCCGCCAATTTACCTTGACTGCAATGCATCAACGCCCATCGACCCTGCGGTTTTTGACGCCATGCGGC
CCTGGCTCGTCAACGATTTTGGAAATTCGAGCAGTAGAACACACGAATTCGGCCTCAAGGCAAAGCGCGC
GGTTGCGCTTGCGAGGAAGCAGATCGCCAGTGCCTTCGGAGTTGATCAAGAAGAAGTTGTATTCACTAGT
GGCGCGACAGAAAGCAACAACCTTGCGATTCTCGGGCTGGCGAGTTGGGGCGAGCAGACTGGCCGCAAGC
ATCTCATCACTTCCGCGATGGAGCACAGTGCTGTTCTTGAGCCTATCGCTTGGCTTCGAGATAACGCCGG
TTTTTCCGTCACGGAGCTTCCCGCTTCATCGGACGGCATCATAGACCCAGACGACCTTAGGCGGTCACTC
CGGCCCGATACCGCTCTCGTATCCCTGATGCAGGTGAACAATGAGACGGGTGTGATCCAACCCCTCCGTG
AACTCGCAATAGTACTTACAGATCACCCTGCATACTTCCACGTCGATGCTGCTCAAGGATTTGGCAAAGA
ATTCACAGAAATCTCGGCGAGAAGGATCGACCTTATCTCTTGCACCGGTCACAAGATCTATGGGCCTCAA
GGCATTGGCGCACTCGTTGTAAAGCGCACTCACGAGCGGCCCATTCCTCTGAAACCTCTTACGTTTGGCG
GTGGACACGAACGTGGACTCAGGCCAGGCACCCTTCCTACCCACCTGATTGTTGGATTCGGTAGTGCTGC
ATCCTTGGCTGTTGCCGACCACAAAGCCCGTGAGAGCAAGAATCGCAGTTTCCGGAAGCAATTGTTCGAG
GGGCTCGACGGATTGCCTTTGACTACTCACGGAGCCCCAAATTTGGTAATTCCGCACGTAACGAACCTCA
GCATCGATGGGGTCTCTTCTGAAGCAGCTATGGTAGCGCTTAGGCAGTACATCGCGATTTCAAATGGTTC
AGCCTGCTCATCGGCGAAGTATGAGCCGAGCCACGTCTTGCGAGCCATGGGACTTTCTAATGAGCAATTG
GATGGAGCAATGCGGTTTTCTTGGTGCCACCTCACACCTGAGGTTGATTGGCGCGCCGTTCGGGCACTAC
TTGCGGAATTTCTTTAG