Summary Sequence Context  
1 homologue found:

HomologuedndB
OrganismAcidobacterium capsulatum ATCC 51196
GID1132
PID2132
Locus tagACP_3186
Locations3683415..3684494
Length1080 bp
G+C%51
Link NCBI: gi:225871699  
SequenceATGGATGTGGCATTCGAGTACCGGTTCCCCGCGATTCGCGGGATTCAATCGAACCGGGAGTACTACATCT
CAATGTGCCCCTTACGATTGATTCCAAAGCTATTTATCTTCGATGAGGCAGAGCTGCGTCCTGAGCTTCG
CGCCCAGAGAACCCTCAACCGCGCACGGATACCGGAAATATCCGACTACATCGTCAAGAACAGAGACTCG
TACACGTTTTCTGCCATTACGGCATCTGTAGACGGCGGCATTCAGTTCGAGCCGATGAGCCAAGACGTGT
CTATGACAAGACTGGGCCTTTTGCGTGTCGAGATGAATGCGAAGTTCATCATCAACGATGGGCAGCATCG
CCGAGCCGCGATTGAAAATGCGCTGAAAGCAGATCCTAGTCTCGGAGACGAGAGCATTGCCGTCGTGTTT
TTTCATGACCGTGGATTGGCTCGAAGCCAGCAGATGTTCGCAGATCTAAACATGCATGCGGCACGCCCTT
CGCGTTCATTAGGTCTTCTCTATGAACAGCGGGACGACTTGGCTCTGATAACGAAAGAAGCGATTCCTCG
TACGAAGATCTTTCGAGATATGGTCGAGTTTGAGCGTTCCACGCTTGCGGAGCGTTCACGAAAACTTTTT
ACGCTTAGTGCCATTTACGGAGCGAACAAAGTCCTTACGGAGAATAGGCCGTTTGAAAACCGAACTGAAG
TGCTGCAGTTCCTTATCGATTTTTGGGACACTGTTGGCTCCCATATGAAGGAATGGCAGTTGATTCAACA
AGGCCGCCAAACTTCAGGTGAACTGCGTAGGGATTTCATTCATGCGCATTCTATCGCTCTACATGCCCTG
GGCATTGTGGGACGGGACTTGGTTCAGCAGTTCCCGAAGAACTGGAAGGGAAAGCTCCGAAAATTGCGTG
ACATAGATTGGTCGCGGTCGAATACCAAAGACTGGGAGGGCCGGGCGATGTTGGCAGGGGCAATCGCGAA
GACCAATTCGAGCCAACTGCTCATGGCTAATCACATACAGAAAAAGTTAGGACTGGAGCTGACACGTACG
GTTAAGGACATGAAGGGAGCCAACAAATGA