Summary Sequence Context  
1 homologue found:

HomologuedndC
OrganismAcidobacterium capsulatum ATCC 51196
GID1133
PID2133
Locus tagACP_3185
Locations3681880..3683418
Length1539 bp
G+C%50
Link NCBI: gi:225871699  
SequenceATGAAATCACCTCAAGTGGGCCGACAATCTGCATTCAAGGCGCAGGGCTTTCGGAAGACATTGGAACTCC
TAGCAGAGAACGTGCAGGCTCTATACCTGTCAGATGAGATTCCATGGGTTGTTGGATACAGTGGAGGGAA
AGATTCAACTGCGACGCTTCAACTAATTTGGACAGCCATTGCTGCACTGCCAGCGGAAAAACGTACAAAG
GTCATTCATGTAATCAGCACCGATACGCTCGTCGAAAACCCGATCATTGCCGGTTGGGTCAATGCGTCTT
TATTAACTATGCAACGGAGCGCGAGTGACCAAGATTTGCCGTTTCGCCCCAATCGCTTGTTGCCGGAGCT
AAAGGACCGTTTTTGGGTAAACATGATCGGGCGCGGATATCCTGCTCCTCGCCCAAAATTTCGTTGGTGT
ACTGAGCGACTAAAGATAAACCCGTCGAATAATTTTATCCGCAACGTCGTCGACGATGCGGGTGAGGTCA
TCTTGGCGTTGGGGACACGAAAGGCGGAAAGCCAGGTGCGCTCGGCTTCGATTGATCATTACTCGAAGAA
TGCGCGGGCTGGATTACAGCGGCATGGACAATTAGACCGAAGTTGGGTATTCTCGCCGATCGTCGATTGG
TCGAACGACGATGTCTGGCAATATCTGATGCAAGTAAAAAATCCTTGGGGTATCGACAATAAGGATCTGC
TGGGGATGTATCAAGGGGCAACTGAAGATGGAGAATGCCCGTTGGTCGTGGATACGAGTACTCCGAGCTG
CGGCGACAGCAGATTTGGTTGCTACGTGTGCACAATGGTGACAGAAGACAAGTCGATGCGATCAATGATC
GCCAACGACTCCGATAAAGCGTGGATGCTTCCGCTTTTGCAGTTTCGTAATCAATATCTTGGAAATCTAA
ACGATCGCAACGTGAGAGAGTTTAAGCGCTTAAATGGTTCCCTCATGGTGCACAACGATCGTTTAGTACA
CGGGCCTTACACCCAGAGCTATCGCGTGAATATGCTTCGGGCCCTATTAGAAACGCAGTTGACAGTGAAC
AAGCACTTACCCAAAGGGATCGACTCCCTCGAACTGATTACCATTGAAGAATTGCGAGAGATACGACGAA
TCTGGATTGAAGATAAGCATGAAGTTGAGGATCTCCTTCCCGCAGTCTATGAAGACACGTTGAAGCGACC
ATTCTCGGCAAACAGCGTGTCTGTGGTGCCGCTGCTCCGCACGTCGGAAATTGAGACGCTTCGCGAGATA
TCGGATGGTCAAACAGTCGAGTCGCGTTTGCACTACGAGCTTCTTCGTGAACTGATCACTACCCAAGCTG
TGTCAAAGAGCACGCACAGCCGTGCGAAGCTACTTGACGAACTGGACCGAGTCCTGGAACGAAGCGCTTT
CGCTGATGCGGACGAAGCATTGAGTGTTGCACTGAGTCGAAGAGGAATGAGTGCATCTGAAGACTCCGGA
CTCGGCGGCCAAGACATGCCTTCGCTGTTCGTCAACATCACACTGCCGGAGCAAAATGACGTTTCTTGA