Summary Sequence Context  
1 homologue found:

HomologuedndD
OrganismAcidobacterium capsulatum ATCC 51196
GID1134
PID2134
Locus tagACP_3184
Locations3679926..3681893
Length1968 bp
G+C%51
Link NCBI: gi:225871699  
SequenceATGACGTTTCTTGAAATTGACTTAGAGAATTTGGGGCCGTTTCGGGGAAGACACGCCATAAAATTGGCGG
TGAGTTCTCCCCGCAATATTGTTCTGATTGGTGCATTGAACGGCAGCGGGAAGACTACCCTCTTAAACGC
GTTTCAATTGGCTCTATATGGACGAGACTCATTGCCTGGACGTAGTGCCAAGAACTACCAACAGTATCTC
AGGCATCTCATCAACAATCAGGCTGCATTGCATGAGAGCGCAAGCATTACCCTTACGCTGATCCTCGATG
ATCTTGCAGACGATTGTCACATACGTGTGGAACGCCGGTGGTGGCGGAGTCAGAACAATGAAGTGCGAGA
GCAACTCACGGTGTGGAAGGGGTCTGAGGCAAGTGACGATCTAACGCAGACTTGGGACACGTTCATCGCA
AGCATCCTGCCGGCTCGTGTTGCCGATCTTTTCTTCTTGGACGGCGAAAAGATTGAGGCACTGACTGCCC
CAGACCAAGCTGCTTCTATCATCAGGAAAGGCATCTTCACACTATTAGATCTTGATCGGATCGAGGAACT
CCGGGCCAATCTCCGAGTAGTCAAGCGGAGGCGTCTGAATTCCATAGAGGGCGAAGAGAACTCCGACGAA
ATTCGAGTGCTTGAAGGTAAAGTAGCTGAAAGTCTCGAAAAGCGCTCGACACTCGCACAGGAGCGCGCGT
CGCTCACGAACGTTCTTGATCGAGCTAATATGCGGGTCTTGAACGCAGAGCGAACCTTCCGTGAAGGTGG
GGGTGAGCTCTTTGAACGGCGGGAACGCTGGGTACGTCGACAGACCGAGCTACATGCAGCGTCACGACAC
ACCTCAGATCAGTTGCGGCAGATCGCTGGTCGTGAACTTCCTCTATTGGCGTGTTCTGCATTGGTCGATC
AAGGTATCGATGCTGTGAGGCGCAGCGATGAGGCACAGCGGCTTTCGATCACCATCGAGGCCATCCGAGC
GCGTGACAAAGAGTATGTTCGAATCCTGCGAGAACTTCAGTTGCCTGCTTCGATCGGCAAGGAAATTGCA
GCTGAACTCGCTCATACAGTGCCTACTATTCCATCTAACACGCCTCCAACGAGCTTCGGAATTCGAAGCG
AGCGTTTGGAGAGGTATTCCGCTGCTCAACGCAAGCGACTGAACAAAGATGTAAGTGCCCTCTTAAAGGA
ATCTGAAAAGCAAAAGAATGAACTGGCGGAGGTTGATCAAGCTATCGAAGCCGTCCCCTCTGAAGAGCAG
ATTGCCGAGCTTACGTGGGAGCTGAAAGATGCAAACGCGGAGCTCGCGCGCGTACAGGCGGCTATGGCGA
ATCTAGATGACCAGATCGAACGTTGGAATCGACAAATTGAGGATGCACGTAAGAACTTGGACTCCGCACT
TGGCACACGACTGAAACAGGGTATTTCGAATGCAGAAGCGGAACGAGTGGTACGCCATATTGAGTTGGTA
GATAGGTCCCTGCAGGAATATCTGGTCAAAATGGTTGAGAGGCATTCCGGAGACATCAGCTCGAAAATCT
TAGCCAGCTTCCGCCTAATCGCACGCAAGCCTGAACTTCTTTCTGGTTTGAAGATCGATCCGCACACTTT
CCATATGAGTCTCACAGGAAACTCTGGAAAGCATATAGATCCAGGTGAATTGTCTGCAGGAGAACGGCAG
ATTCTTGCGTTTGCGATACTCGATGGATTGGCGAAATCCTCCGGTCGTCAGATTCCGACTCTTATTGACA
GCCCATTGGGGCGTCTCGATGGCATACATCGTCAACGAATCGCGCAGCACTACTTGCCAAGCGCTTCCCA
CCAAACGATTGTTTTCTCGACCGACAAAGAAGTCGACGAACAGATGCTCAGGATGCTCAACCACAACATA
GCAGCAAGTTATTTGCTGAATTTCAACGAGAAGGCTTATGGCACAGAAATCAAAAACGGATACTTTCAAG
CCGGGTGA