Summary Sequence Context  
1 homologue found:

HomologuedndE
OrganismAcidobacterium capsulatum ATCC 51196
GID1135
PID2135
Locus tagACP_3183
Locations3679544..3679966
Length423 bp
G+C%50
Link NCBI: gi:225871699  
SequenceATGGCACAGAAATCAAAAACGGATACTTTCAAGCCGGGTGACCCGTTTCCCATCGATACGATACGAGTAT
CTGAGCGTGCAAAACAGCAACTGATTACGCTCAAGAGAAATACCGGGATCGAACACTGGAACGTGCTGTG
CCGGTGGGCCCTATGTGTTTCCCTTCAAGAACCCTCGAAGCCTCCTATAGAGGGCGAAAGCGCACTGAGC
TCTCTTGAAATGCATTGGAAGACTTTCGCTGGTCATGAAGAAGATGCATACAAGGCAGTCTTGTTGGCCC
GTGTTATCAAAGATTTTGGGACCGTGTCGCCATCGCTGATTAGCACGCAATTCCGGCTGCACCTTCACAG
AGGAATTTCTCGATTAGCTGGCAAGAAGATCCGATCAATCGAGGACTTGGTAAGAGTCGCGGTAGACGCG
TAG