Summary Sequence Alignment 16S rRNA Context  
4 homologues found:

HomologuedndE
OrganismTolumonas auensis DSM 9187
GID1136
PID2136
Locus tagTolaDRAFT_2703
Locations292010..292357
Length348 bp
G+C%37
Link NCBI: gi:223578584  
SequenceATGCTACCGAATCGAATGAACTTAAGCCTATCAACAGAAGAGCAGCTCAAGAAATTAAAAAGCTATACCG
GTATTACGCCTAATATTTCTGCTCGTATCGCTTTTTTTCGTTCAATAGAGAGTGATTTTCGTTATTCTGG
CCAAGAAGCAAAGCTGGATGGTACTTTAGTTTTGGATAAGTTTACTTGGCTTGGGGAAACCAGTGATATA
ACCGAGCTGATGTTAAAACTCTACTATCCAAACTTAGATGGTAAGAAATATCAGCAAGCATGGGCTGCTC
ATGTTGAGTACGGTATATCCTCTTTGAGGAACCATAAATCACTATTAAACTTAGGAATAAAATTGTAA

HomologuedndD
OrganismTolumonas auensis DSM 9187
GID1137
PID2137
Locus tagTolaDRAFT_2704
Locations292357..294372
Length2016 bp
G+C%40
Link NCBI: gi:223578584  
SequenceATGCTAATAACCAAACTAAGTCTTAATAACTTTCGCGTATTTTGTGGATTGCACGAGATCGACCTAACGC
CATCAAGTGCAGCTCATAATGCTAAAGGTGAAGAAATACCCGGAACAGAACGCTCTATTATTCTATTTGG
TGGGTTAAACGGCGCAGGGAAAACTTCGATTTTAACAGCAGTTCGTCTAGCTCTTTATGGCCGTCTCTCT
TTTGGTAAGCCACTTCATAATAATGAATACATCGAGGAGCTTTCCGAGCTAATTCACAAGGGGAATGGCA
TAAATTCACCAGAAAATGCATATATTGAACTTGCATTTACCCATAACCAAGCAGGTTCAGAAAATACGTA
TAAAGTTACGAGAAGCTGGAAGAAAGGCAAAGCTGATAAATTGATTCTTGAACAAGATGGCAAGGATCTA
TCAGAACTCAGCTATGATCAATGCCAAGGCTTTTTAAATGAGCTGATTCCGAACGGTATTGCTGACCTAT
TCTTCTTTGATGGTGAAAAGATTGCGGAGTTAGCTGAAGATGAATCGGGAACTATACTGAACACTGCTGT
TAAACGTTTACTGGGGTTGGATGTTATCGCCAAGCTTAAAAGTGACCTAAATATCTATCTAAAAAAACAA
GGCGCGACATTACTCGAAACGTCTATCAAGCAACAATTAGATAATTTGGATGAGACTCGAATCAAGCATG
AACGTAATGCTGAAAAGTTACGTCATGAGGCTAATCAAGTGCTCATTCAGATTGAGCATGTCTCGCAAGA
GATTCAAAAACTTGAAGCTGAACTATCAAGTAGCGGTGGCGCTTGGGCTGAAACACGCGAACAAGAAGAA
CAGAAAATTGATCAGTTGCTTAAAGAAAAACTCGAGCTGGAAAAGCAAATCCGTATGGAGATGGAAACCA
GCCTTCCCTTTGCTTTAGCACCGAATTCAATGAAAGCACTACTGTCTCAGATTGAAAAAGAGAGAGCACT
TAAGCAAAAGCAACACTTTGCTAAAGAGCTAGATGGATTTCTGGATACTTTGAGAAAAGACCTTTCATTT
CGTTTAGCTGATTCAAACGTTGCCATGGATGCCATTGCAGACTGCTTCAACTACTATGTTTCAGATGATT
CTAACCAAGCACTTTTGTTAGATATCTCTGATCGCCAAGCTAACGCCATCGAATACCAAGTAAATCAAAG
TAGTCATCGTTCATACGAGCGTTTCGATAAGGCTCGTTCTAGACTAGGTCAAGTTGAGGAGTTACTGGAT
AACATTTCTCAAAACGTTGCTCGAGCACCGGAAAAAGAACAGTTACAAGGTACACTAGATAAAATTCGAG
CAAGAGATAAGAAGAAACAGGAGCTATGCTCCGACTACCAGGCACTTCTAGAAGATGCTAAACAAGAACT
ACGTTTGGCACTCGAAACAGCTCGTCAAATACAGAAATTGCATGACAAGCACAGAGATAACGCAAATAAA
AATGCGAGTGTCGAGAATGCACAAAATACAATTTTATTATTGAGTAAGTTCGCAGATCAACTAACTAAGT
CTCGGGTTAAGTCTCTGGAACAGCACTTTGTTGAGTCTTATAAAAAACTGGCTCGCAAAGAGGATCTACA
GCTCTGTGCTTTAATCAATCCCAAATCTTTTGATGTTGAACTTATTGATGAACATGGAAATAAGATCAAT
CGCAAGGCAATGTCTGCAGGTGAGAAACAAATCTATGCTATTTCTATTCTTGAAGCATTGGGAAAAACCT
CAGGCCGTAAGTTACCTATTATCATCGATACACCTCTAGGTAGATTGGATTCTCATCACCGCGATAAGCT
GGTAGAAAACTACTTCCCAACAGCAAGCCATCAAGTCGTGATTCTGTCTACGGATACGGAAATTGATAAA
GACTATATCAGGCTTATTGAAGATGACATCGCCAAAACTTATGAAATTTGTTTTGACGGCAAATCAAAAT
CATCTCATATAAAGCAAGGTTACTTCTGGAAACAAGTAATACAGGAGGCCGTGTAA

HomologuedndC
OrganismTolumonas auensis DSM 9187
GID1138
PID2138
Locus tagTolaDRAFT_2705
Locations294382..296013
Length1632 bp
G+C%43
Link NCBI: gi:223578584  
SequenceATGACAGATCAACTCCTACTGGCAGAAGACCTCGAAGGATATGAAGAGTTTATTAATCAAGAATATTTCG
CAGGTTTAAAGCTCAACCATTATATTGCTGATGTCCAGCGAATCTATTGCGCTGATAAACGCCCATGGGT
TATTGGCTATAGTGGTGGCAAAGACTCTTCTGCAGTCATGTCTCTCGTTTATATGGCACTGTTAGGTTTA
CCAAAAGATCAACGGCAAAAACCAGTGTTTGTTGTATCGTCCGATACCTTGGTTGAAACTCCTGTTGTCG
TAAATCATATAAAAAACTCTCTTAAAGCGATCGAATCTGGCGCTAGGCGAGATGGTTTGCCAATCACGAC
TCATCAAGTCGTTCCAAAGAGTAATGATACCTTTTGGGTAAACTTACTTGGCAAAGGCTACCCGGCCCCA
ACACGCTCATTCCGTTGGTGTACCGAGCGGATGAAAATCGATCCAGTCAGTGATTTTATTAAAACTACAG
TTTCAAAATATGATGAAGTAATCGTTGTACTGGGTTCTCGAAGCCAAGAAAGTGCCTCACGTGCGCAAGT
GATTGCTAAACATAAAATAGATGGTTCCCGGCTCGCTCGCCATACCACGCTTGCAAATGCGTTTATCTTC
ACACCAATCGATACATGGTCTGTCGATGATGTTTGGAAGATCTTGCGTCTTTGTCATTTAGAGACTCAAG
ACTCACCTTATGGAGTTAAGAATATCTGGAAAGATATCTACGATCTTGAATGGGAAAACCCATGGGGCGG
CAAAAACCTCACTCTTTGGAATTTGTATAGAGACTCATCAGGCCAAGGTGAATGCCCGATGGTAATCGAC
GAAACGACACCATCATGTGGCAATTCTCGTTTTGGATGCTGGACTTGCACCGTCGTGACAAAAGATAGAG
CAATGGAAAGCTTAATTGAAAATGGTGAAGAGTGGATGAACCCACTTTTAGAATTCCGAAACAAATTAGC
TTTTACTACAGACCCTGAAAACAAAGATGAATTTCGTAATTACAAACGTCGTACCGGAAGAGTCGCCTAC
CAATATGCCAAAGAAGGTGAAAATATTGCTACAGAACGTAAGCACGTACCTGGTCCATATTGGTTGAAAT
ATCGTAAGCAGTGGCTTAAGGAACTTCTGGAACTTGATAAACAATACAAAGATGAACGCCGAGAGATTGA
ACTAATTACCGCGCCAGAGTTGCACGCAATTCGACAGGAATGGCTACGAGATCCTAATGAGCCAGATTGG
AATGATTCTCTCCCCTCGATTTTTAAGGAAGTGTACGGCTTCGATCTTGATTGGATCTATGATGACGGAG
CAAGTTTTGGTAAAGACGAGGCTGCACTGCTGCGTGAACTAAGTTCTGATTTCGATGCTGAACCAGAAAT
GGTGATGAAGCTTATCGAATTAGAAATTTCGATGGAAGGCTTAAGTCGTCGCAGTGGCATCAGCGATAAA
ATCGCATCCCTGTTGAAGCAAGATTGGGGCAGTCTAGAATCGATAAAGGACAAACATGCAGCCTTGCAAA
GTCGCGCAGAATACGATGTACACCAAAAAGAAATCGATCGATATAACCAAGAGCTAGCAGAAATTGAGCT
AGCCCTTAAGAAGGAATTTTAG

HomologuedndB
OrganismTolumonas auensis DSM 9187
GID1139
PID2139
Locus tagTolaDRAFT_2706
Locations296013..297089
Length1077 bp
G+C%43
Link NCBI: gi:223578584  
SequenceATGCATATGAATGATTCTGGATATTGTTACTCGTTCCCCGCTGTGAGAGGGATACAGGCTGGACGTCCGT
TTTATATTGCGACCTGCCCTCTTCGGATAGTCCCAAAGATATTTAGTTACAATGAGGATGATGTTCCTCC
AGAGCTTCGCGCTCAGCGCACCCTAAACAAAACACGAATCCCTGATATGGTTAAGTATCTTCTCGATAAT
CCAAAGGATTACGTTTTTTCTGCGCTGACAGCGTCCGTTGGTACATCGATATCATTTGAAGAAATAGGCG
AAGCACCAAATCTTGGCATTCTTCAAATCCCAATGGATGCACAAATCCTGATCAACGACGGGCAACATCG
AAGAAAAGCAATTGAAGAAGCGCTTAGAGAGAACCCTGACTTAGGGCAGGATAATCTTCCAGTACTCTTC
TTTGTTGATGAAGGACTTACTCGCAGCCAGCAAATGTTTGCTGACCTTAACAAGTACGCCGTAAAACCAA
GTACATCTTTGGGAACACTTTATGACCATAGAGACGAAAGTTCAGAACTAGCAAGATACCTTGCGATGGA
AATAGAGCCTTTCATTGGCTTCACTGAAATGGAAAAGTCAAACGTAAGCCCTAAGTCGAATAAGCTATTC
ACTCTAAGTGCCATAAAACAAGCAACAAAGGCTCTACTGAGTAAAGGTCCTCGAGATGGCTTCTCTGAAG
AAGAACAAAGATTGTCAATTGAATACTGGAAAGCAGTGACCAAATATATACCTGATTGGCAGATGATGCT
TAACAAAAAAGTATCGCCAAGCCAACTGCGCCAGGAGTTTATTCACGCACATGGTGTCGGGTTACAAGCA
CTGGGAATCGTCGGTAAACAACTCTTAAGTGAACACCCCAACGACTGGGAATCCCGATTGAAACCGTTAC
AATCCATTGATTGGCGAAAAGCGAATCCTGATTGGGTAAAACGCACAATGAACCATGGTCGTATTTCTAA
GTCAACGACCAGCATTCTACTTACCAGTAACGCGTTAAAGCTCAAATTAGGCTTGGCACTAACACCTGAT
GAAAAAACACTAGAGAAACAATTGTAA