Summary Sequence Context  
1 homologue found:

HomologuedndB
OrganismTolumonas auensis DSM 9187
GID1139
PID2139
Locus tagTolaDRAFT_2706
Locations296013..297089
Length1077 bp
G+C%43
Link NCBI: gi:223578584  
SequenceATGCATATGAATGATTCTGGATATTGTTACTCGTTCCCCGCTGTGAGAGGGATACAGGCTGGACGTCCGT
TTTATATTGCGACCTGCCCTCTTCGGATAGTCCCAAAGATATTTAGTTACAATGAGGATGATGTTCCTCC
AGAGCTTCGCGCTCAGCGCACCCTAAACAAAACACGAATCCCTGATATGGTTAAGTATCTTCTCGATAAT
CCAAAGGATTACGTTTTTTCTGCGCTGACAGCGTCCGTTGGTACATCGATATCATTTGAAGAAATAGGCG
AAGCACCAAATCTTGGCATTCTTCAAATCCCAATGGATGCACAAATCCTGATCAACGACGGGCAACATCG
AAGAAAAGCAATTGAAGAAGCGCTTAGAGAGAACCCTGACTTAGGGCAGGATAATCTTCCAGTACTCTTC
TTTGTTGATGAAGGACTTACTCGCAGCCAGCAAATGTTTGCTGACCTTAACAAGTACGCCGTAAAACCAA
GTACATCTTTGGGAACACTTTATGACCATAGAGACGAAAGTTCAGAACTAGCAAGATACCTTGCGATGGA
AATAGAGCCTTTCATTGGCTTCACTGAAATGGAAAAGTCAAACGTAAGCCCTAAGTCGAATAAGCTATTC
ACTCTAAGTGCCATAAAACAAGCAACAAAGGCTCTACTGAGTAAAGGTCCTCGAGATGGCTTCTCTGAAG
AAGAACAAAGATTGTCAATTGAATACTGGAAAGCAGTGACCAAATATATACCTGATTGGCAGATGATGCT
TAACAAAAAAGTATCGCCAAGCCAACTGCGCCAGGAGTTTATTCACGCACATGGTGTCGGGTTACAAGCA
CTGGGAATCGTCGGTAAACAACTCTTAAGTGAACACCCCAACGACTGGGAATCCCGATTGAAACCGTTAC
AATCCATTGATTGGCGAAAAGCGAATCCTGATTGGGTAAAACGCACAATGAACCATGGTCGTATTTCTAA
GTCAACGACCAGCATTCTACTTACCAGTAACGCGTTAAAGCTCAAATTAGGCTTGGCACTAACACCTGAT
GAAAAAACACTAGAGAAACAATTGTAA