Summary Sequence Context  
1 homologue found:

HomologuedndC
OrganismTolumonas auensis DSM 9187
GID1138
PID2138
Locus tagTolaDRAFT_2705
Locations294382..296013
Length1632 bp
G+C%43
Link NCBI: gi:223578584  
SequenceATGACAGATCAACTCCTACTGGCAGAAGACCTCGAAGGATATGAAGAGTTTATTAATCAAGAATATTTCG
CAGGTTTAAAGCTCAACCATTATATTGCTGATGTCCAGCGAATCTATTGCGCTGATAAACGCCCATGGGT
TATTGGCTATAGTGGTGGCAAAGACTCTTCTGCAGTCATGTCTCTCGTTTATATGGCACTGTTAGGTTTA
CCAAAAGATCAACGGCAAAAACCAGTGTTTGTTGTATCGTCCGATACCTTGGTTGAAACTCCTGTTGTCG
TAAATCATATAAAAAACTCTCTTAAAGCGATCGAATCTGGCGCTAGGCGAGATGGTTTGCCAATCACGAC
TCATCAAGTCGTTCCAAAGAGTAATGATACCTTTTGGGTAAACTTACTTGGCAAAGGCTACCCGGCCCCA
ACACGCTCATTCCGTTGGTGTACCGAGCGGATGAAAATCGATCCAGTCAGTGATTTTATTAAAACTACAG
TTTCAAAATATGATGAAGTAATCGTTGTACTGGGTTCTCGAAGCCAAGAAAGTGCCTCACGTGCGCAAGT
GATTGCTAAACATAAAATAGATGGTTCCCGGCTCGCTCGCCATACCACGCTTGCAAATGCGTTTATCTTC
ACACCAATCGATACATGGTCTGTCGATGATGTTTGGAAGATCTTGCGTCTTTGTCATTTAGAGACTCAAG
ACTCACCTTATGGAGTTAAGAATATCTGGAAAGATATCTACGATCTTGAATGGGAAAACCCATGGGGCGG
CAAAAACCTCACTCTTTGGAATTTGTATAGAGACTCATCAGGCCAAGGTGAATGCCCGATGGTAATCGAC
GAAACGACACCATCATGTGGCAATTCTCGTTTTGGATGCTGGACTTGCACCGTCGTGACAAAAGATAGAG
CAATGGAAAGCTTAATTGAAAATGGTGAAGAGTGGATGAACCCACTTTTAGAATTCCGAAACAAATTAGC
TTTTACTACAGACCCTGAAAACAAAGATGAATTTCGTAATTACAAACGTCGTACCGGAAGAGTCGCCTAC
CAATATGCCAAAGAAGGTGAAAATATTGCTACAGAACGTAAGCACGTACCTGGTCCATATTGGTTGAAAT
ATCGTAAGCAGTGGCTTAAGGAACTTCTGGAACTTGATAAACAATACAAAGATGAACGCCGAGAGATTGA
ACTAATTACCGCGCCAGAGTTGCACGCAATTCGACAGGAATGGCTACGAGATCCTAATGAGCCAGATTGG
AATGATTCTCTCCCCTCGATTTTTAAGGAAGTGTACGGCTTCGATCTTGATTGGATCTATGATGACGGAG
CAAGTTTTGGTAAAGACGAGGCTGCACTGCTGCGTGAACTAAGTTCTGATTTCGATGCTGAACCAGAAAT
GGTGATGAAGCTTATCGAATTAGAAATTTCGATGGAAGGCTTAAGTCGTCGCAGTGGCATCAGCGATAAA
ATCGCATCCCTGTTGAAGCAAGATTGGGGCAGTCTAGAATCGATAAAGGACAAACATGCAGCCTTGCAAA
GTCGCGCAGAATACGATGTACACCAAAAAGAAATCGATCGATATAACCAAGAGCTAGCAGAAATTGAGCT
AGCCCTTAAGAAGGAATTTTAG