Summary Sequence Context  
1 homologue found:

HomologuedndD
OrganismTolumonas auensis DSM 9187
GID1137
PID2137
Locus tagTolaDRAFT_2704
Locations292357..294372
Length2016 bp
G+C%40
Link NCBI: gi:223578584  
SequenceATGCTAATAACCAAACTAAGTCTTAATAACTTTCGCGTATTTTGTGGATTGCACGAGATCGACCTAACGC
CATCAAGTGCAGCTCATAATGCTAAAGGTGAAGAAATACCCGGAACAGAACGCTCTATTATTCTATTTGG
TGGGTTAAACGGCGCAGGGAAAACTTCGATTTTAACAGCAGTTCGTCTAGCTCTTTATGGCCGTCTCTCT
TTTGGTAAGCCACTTCATAATAATGAATACATCGAGGAGCTTTCCGAGCTAATTCACAAGGGGAATGGCA
TAAATTCACCAGAAAATGCATATATTGAACTTGCATTTACCCATAACCAAGCAGGTTCAGAAAATACGTA
TAAAGTTACGAGAAGCTGGAAGAAAGGCAAAGCTGATAAATTGATTCTTGAACAAGATGGCAAGGATCTA
TCAGAACTCAGCTATGATCAATGCCAAGGCTTTTTAAATGAGCTGATTCCGAACGGTATTGCTGACCTAT
TCTTCTTTGATGGTGAAAAGATTGCGGAGTTAGCTGAAGATGAATCGGGAACTATACTGAACACTGCTGT
TAAACGTTTACTGGGGTTGGATGTTATCGCCAAGCTTAAAAGTGACCTAAATATCTATCTAAAAAAACAA
GGCGCGACATTACTCGAAACGTCTATCAAGCAACAATTAGATAATTTGGATGAGACTCGAATCAAGCATG
AACGTAATGCTGAAAAGTTACGTCATGAGGCTAATCAAGTGCTCATTCAGATTGAGCATGTCTCGCAAGA
GATTCAAAAACTTGAAGCTGAACTATCAAGTAGCGGTGGCGCTTGGGCTGAAACACGCGAACAAGAAGAA
CAGAAAATTGATCAGTTGCTTAAAGAAAAACTCGAGCTGGAAAAGCAAATCCGTATGGAGATGGAAACCA
GCCTTCCCTTTGCTTTAGCACCGAATTCAATGAAAGCACTACTGTCTCAGATTGAAAAAGAGAGAGCACT
TAAGCAAAAGCAACACTTTGCTAAAGAGCTAGATGGATTTCTGGATACTTTGAGAAAAGACCTTTCATTT
CGTTTAGCTGATTCAAACGTTGCCATGGATGCCATTGCAGACTGCTTCAACTACTATGTTTCAGATGATT
CTAACCAAGCACTTTTGTTAGATATCTCTGATCGCCAAGCTAACGCCATCGAATACCAAGTAAATCAAAG
TAGTCATCGTTCATACGAGCGTTTCGATAAGGCTCGTTCTAGACTAGGTCAAGTTGAGGAGTTACTGGAT
AACATTTCTCAAAACGTTGCTCGAGCACCGGAAAAAGAACAGTTACAAGGTACACTAGATAAAATTCGAG
CAAGAGATAAGAAGAAACAGGAGCTATGCTCCGACTACCAGGCACTTCTAGAAGATGCTAAACAAGAACT
ACGTTTGGCACTCGAAACAGCTCGTCAAATACAGAAATTGCATGACAAGCACAGAGATAACGCAAATAAA
AATGCGAGTGTCGAGAATGCACAAAATACAATTTTATTATTGAGTAAGTTCGCAGATCAACTAACTAAGT
CTCGGGTTAAGTCTCTGGAACAGCACTTTGTTGAGTCTTATAAAAAACTGGCTCGCAAAGAGGATCTACA
GCTCTGTGCTTTAATCAATCCCAAATCTTTTGATGTTGAACTTATTGATGAACATGGAAATAAGATCAAT
CGCAAGGCAATGTCTGCAGGTGAGAAACAAATCTATGCTATTTCTATTCTTGAAGCATTGGGAAAAACCT
CAGGCCGTAAGTTACCTATTATCATCGATACACCTCTAGGTAGATTGGATTCTCATCACCGCGATAAGCT
GGTAGAAAACTACTTCCCAACAGCAAGCCATCAAGTCGTGATTCTGTCTACGGATACGGAAATTGATAAA
GACTATATCAGGCTTATTGAAGATGACATCGCCAAAACTTATGAAATTTGTTTTGACGGCAAATCAAAAT
CATCTCATATAAAGCAAGGTTACTTCTGGAAACAAGTAATACAGGAGGCCGTGTAA