Summary Sequence Context  
1 homologue found:

HomologuedndE
OrganismTolumonas auensis DSM 9187
GID1136
PID2136
Locus tagTolaDRAFT_2703
Locations292010..292357
Length348 bp
G+C%37
Link NCBI: gi:223578584  
SequenceATGCTACCGAATCGAATGAACTTAAGCCTATCAACAGAAGAGCAGCTCAAGAAATTAAAAAGCTATACCG
GTATTACGCCTAATATTTCTGCTCGTATCGCTTTTTTTCGTTCAATAGAGAGTGATTTTCGTTATTCTGG
CCAAGAAGCAAAGCTGGATGGTACTTTAGTTTTGGATAAGTTTACTTGGCTTGGGGAAACCAGTGATATA
ACCGAGCTGATGTTAAAACTCTACTATCCAAACTTAGATGGTAAGAAATATCAGCAAGCATGGGCTGCTC
ATGTTGAGTACGGTATATCCTCTTTGAGGAACCATAAATCACTATTAAACTTAGGAATAAAATTGTAA