![]() | 308 |
![]() ![]() | ICESpaNUF1049 ![]() |
![]() ![]() | ICEO_0000260 |
![]() | Tn916 |
![]() | Streptococcus parauberis NUF1049 |
![]() | 18031 |
![]() | 38.71 |
![]() | AT rich regions |
![]() | tetracycline resistance |
![]() | - |
![]() | AB468159 (complete ICE sequence in this GenBank file) |
![]() | - |
![]() | 3016..21046 |
![]() ![]() | coordinates: 2501..2633; oriTDB id: 200001 TTATTGTTGTAATAATTAATATTTTTTATAATAGCTTGTTCTGTAATAATCCGACCCTCAACAGGTATAC CTGTGATTTGAGCTACTAAATTAAGATGAGCATCCTAGGCTGTTTTATCTAAACCCAAAGTCT |
![]() ![]() | coordinates: 5875..6864; Gene: O20; Family: MOBT |
The graph information of ICESpaNUF1049 components from AB468159 | |||||
![]() | |||||
Complete gene list of ICESpaNUF1049 from AB468159 | |||||
# | Gene ![]() | Coordinates [+/-], size (bp) | Product (GenBank annotation) | *Reannotation ![]() | |
1 | Sp-O1 | 842..1381 [+], 540 | hypothetic protein | ||
2 | Sp-O2 | 1390..2379 [+], 990 | hypothetical protein | ||
3 | O24 | 3209..3328 [+], 120 | hypothetical protein | ||
4 | O23 | 3351..3665 [+], 315 | hypothetic protein | ||
5 | O22 | 3681..4067 [+], 387 | hypothetic protein | ||
6 | O21 | 4096..5481 [+], 1386 | hypothetic protein | Orf21_Tn, T4SS component | |
7 | O20 | 5875..6864 [+], 990 | hypothetic protein | Relaxase, MOBT Family | |
8 | O19 | 6907..7128 [+], 222 | hypothetic protein | Orf19_Tn, T4SS component | |
9 | O18 | 7245..7742 [+], 498 | hypothetic protein | ||
10 | O17 | 7717..8223 [+], 507 | hypothetic protein | Orf17_Tn, T4SS component | |
11 | O16 | 8207..10654 [+], 2448 | hypothetic protein | Orf16_Tn, T4SS component | |
12 | O15 | 10657..12921 [+], 2265 | hypothetic protein | Orf15_Tn, T4SS component | |
13 | O14 | 12830..13831 [+], 1002 | hypothetic protein | Orf14_Tn, T4SS component | |
14 | O13 | 13828..14760 [+], 933 | hypothetic protein | Orf13_Tn, T4SS component | |
15 | O12 | 15035..15121 [+], 87 | tet(M) leader peptide | ||
16 | tet(M) | 15137..17056 [+], 1920 | Tn916-like_tet(M) | AR | |
17 | O6 | 17154..17342 [+], 189 | hypothetic protein | ||
18 | O9 | 17402..17755 [-], 354 | putative transcriptional regulator | ||
19 | O10 | 17960..18031 [+], 72 | hypothetic protein | ||
20 | O7 | 18209..18682 [+], 474 | hypothetic protein | ||
21 | O8 | 18679..18909 [+], 231 | hypothetic protein | ||
22 | O5 | 19135..19386 [-], 252 | hypothetic protein | ||
23 | xis-Tn | 19370..19573 [+], 204 | Tn-excisionase | ||
24 | int-Tn | 19898..20872 [+], 975 | integrase | Integrase | |
25 | Sp-O3 | 21126..22313 [-], 1188 | hypothetic protein |
(1) Meng F; Kanai K; Yoshikoshi K (2009). Structural characterization of Tn916-like element in Streptococcus parauberis serotype II strains isolated from diseased Japanese flounder. Lett Appl Microbiol. 48(6):770-6. [PudMed:19344360] ![]() |
![]() |