![]() | 321 |
![]() ![]() | Tn6003 ![]() |
![]() ![]() | ICEO_0000264 |
![]() | Tn916 |
![]() | Streptococcus pneumoniae Ar4 |
![]() | 25101 |
![]() | 37.98 |
![]() | AT rich regions |
![]() | Erythromycin, aminoglycoside, streptothricin and tetracycline resistance |
![]() | - |
![]() | AM410044 (complete ICE sequence in this GenBank file) |
![]() | - |
![]() | 1..25101 |
![]() ![]() | coordinates: 2501..2633; oriTDB id: 200001 ACTTAACCCCCCGTATCTAACAGGGGGGTACAAATCGACAGGAAACAGTCAAAAAAACATTAGAAAATCC TTTGGTTACAAGGGATTTACAAAATTTCAGCGTATGTCAAATGGGCTTTAAAAGTTGACATAC |
![]() ![]() | coordinates: 2860..4062; Family: MOBT |
The graph information of Tn6003 components from AM410044 | |||||
![]() | |||||
Complete gene list of Tn6003 from AM410044 | |||||
# | Gene ![]() | Coordinates [+/-], size (bp) | Product (GenBank annotation) | *Reannotation ![]() | |
1 | - | 194..283 [+], 90 | truncated hypothetical protein | ||
2 | - | 336..650 [+], 315 | hypothetical protein | ||
3 | - | 666..1052 [+], 387 | hypothetical protein | ||
4 | - | 1081..2466 [+], 1386 | hypothetical protein | Orf21_Tn, T4SS component | |
5 | - | 2860..4062 [+], 1203 | hypothetical protein | Relaxase, MOBT Family | |
6 | - | 3895..4062 [+], 168 | MLS leader peptide | ||
7 | ORFM0 | 4111..4194 [+], 84 | MLS leader peptide | ||
8 | ermB | 4319..5104 [+], 786 | - | ||
9 | aadE | 5107..5445 [+], 339 | adenyltransferase | ||
10 | sat4 | 5454..5984 [+], 531 | streptothricin acetyltransferase | ||
11 | aphA-3 | 6077..6871 [+], 795 | aminoglycoside phosphotransferase type III | AR | |
12 | - | 7147..7719 [+], 573 | hypothetical protein | ||
13 | - | 8336..8419 [+], 84 | MLS leader peptide | ||
14 | ermB | 8544..9281 [+], 738 | MLS methylase | AR | |
15 | - | 9226..9417 [+], 192 | hypothetical protein | ||
16 | - | 9538..10785 [-], 1248 | putative transposase | ||
17 | - | 10965..11186 [+], 222 | hypothetical protein | Orf19_Tn, T4SS component | |
18 | - | 11303..11800 [+], 498 | hypothetical protein | ||
19 | - | 11775..12281 [+], 507 | hypothetical protein | Orf17_Tn, T4SS component | |
20 | - | 12265..14712 [+], 2448 | hypothetical protein | Orf16_Tn, T4SS component | |
21 | - | 14715..16892 [+], 2178 | hypothetical protein | Orf15_Tn, T4SS component | |
22 | - | 16889..17674 [+], 786 | hypothetical protein | Orf14_Tn, T4SS component | |
23 | - | 17887..18819 [+], 933 | hypothetical protein | Orf13_Tn, T4SS component | |
24 | - | 19094..19180 [+], 87 | tet(M) leader peptide | ||
25 | tet(M) | 19181..21113 [+], 1933 | - | ||
26 | - | 21211..21399 [+], 189 | hypothetical protein | ||
27 | - | 21459..21812 [-], 354 | hypothetical protein | ||
28 | - | 22017..22088 [+], 72 | hypothetical protein | ||
29 | - | 22266..22739 [+], 474 | hypothetical protein | ||
30 | - | 22736..22966 [+], 231 | hypothetical protein | ||
31 | - | 23187..23441 [-], 255 | hypothetical protein | ||
32 | Xis-Tn | 23425..23628 [+], 204 | excisionase | ||
33 | Int-Tn | 23710..24927 [+], 1218 | integrase | Integrase |
(1) Cochetti I; Tili E; Vecchi M; Manzin A; Mingoia M; Varaldo PE; Montanari MP (2007). New Tn916-related elements causing erm(B)-mediated erythromycin resistance in tetracycline-susceptible pneumococci. J Antimicrob Chemother. 60(1):127-31. [PudMed:17483548] ![]() |
![]() |