![]() | 62 |
![]() ![]() | CTn6002 ![]() |
![]() ![]() | ICEO_0000359 |
![]() | Tn916 |
![]() | Streptococcus cristatus |
![]() | 20880 |
![]() | 38.23 |
![]() | - |
![]() | Erythromycin resistance |
![]() | Streptococcus cristatus; Streptococcus sanguinis |
![]() | AY898750 (complete ICE sequence in this GenBank file) |
![]() | - |
![]() | 1..20880 |
![]() ![]() | coordinates: 2501..2633; oriTDB id: 200001 ACTTAACCCCCCGTATCTAACAGGGGGGTACAAATCGACAGGAAACAGTCAAAAAAACATTAGAAAATCC TTTGGTTACAAGGGATTTACAAAATTTCAGCGTATGTCAAATGGGCTTTAAAAGTTGACATAC |
![]() ![]() | coordinates: 2860..4062; Family: MOBT |
The graph information of CTn6002 components from AY898750 | |||||
![]() | |||||
Complete gene list of CTn6002 from AY898750 | |||||
# | Gene ![]() | Coordinates [+/-], size (bp) | Product (GenBank annotation) | *Reannotation ![]() | |
1 | - | 194..313 [+], 120 | hypothetical protein | ||
2 | - | 336..650 [+], 315 | hypothetical protein | ||
3 | - | 666..1052 [+], 387 | hypothetical protein | ||
4 | - | 1081..2466 [+], 1386 | hypothetical protein | Orf21_Tn, T4SS component | |
5 | - | 2860..4062 [+], 1203 | hypothetical protein | Relaxase, MOBT Family | |
6 | - | 3895..4062 [+], 168 | MLS leader peptide | ||
7 | - | 4111..4194 [+], 84 | MLS leader peptide | ||
8 | - | 4319..5056 [+], 738 | MLS methylase | AR | |
9 | - | 5001..5192 [+], 192 | hypothetical protein | ||
10 | - | 5313..6560 [-], 1248 | hypothetical protein | ||
11 | - | 6740..6961 [+], 222 | hypothetical protein | Orf19_Tn, T4SS component | |
12 | - | 7078..7575 [+], 498 | hypothetical protein | ||
13 | - | 7550..8056 [+], 507 | hypothetical protein | Orf17_Tn, T4SS component | |
14 | - | 8040..10487 [+], 2448 | hypothetical protein | Orf16_Tn, T4SS component | |
15 | - | 10490..12667 [+], 2178 | hypothetical protein | Orf15_Tn, T4SS component | |
16 | - | 12664..13449 [+], 786 | hypothetical protein | Orf14_Tn, T4SS component | |
17 | - | 13662..14594 [+], 933 | hypothetical protein | Orf13_Tn, T4SS component | |
18 | - | 14869..14955 [+], 87 | hypothetical protein | ||
19 | - | 14971..16890 [+], 1920 | tetracycline resistance protein TetM | AR | |
20 | - | 16988..17176 [+], 189 | hypothetical protein | ||
21 | - | 17236..17589 [-], 354 | hypothetical protein | ||
22 | - | 17794..17865 [+], 72 | hypothetical protein | ||
23 | - | 18043..18516 [+], 474 | hypothetical protein | ||
24 | - | 18513..18743 [+], 231 | hypothetical protein | ||
25 | - | 18969..19220 [-], 252 | hypothetical protein | ||
26 | - | 19204..19407 [+], 204 | Xis-Tn | ||
27 | - | 19489..20706 [+], 1218 | Int-Tn | Integrase |
(1) Warburton PJ; Palmer RM; Munson MA; Wade WG (2007). Demonstration of in vivo transfer of doxycycline resistance mediated by a novel transposon. J Antimicrob Chemother. 60(5):973-80. [PudMed:17855723] ![]() |
![]() |