ICEberg
I. Information of IME
ICEberg ID181_IME
Name MGIVvuTai1 This IME is derived from experimental literature
Family-
OrganismVibrio vulnificus YJ016
Size (bp)19.0 kb
GC content [Genome] (%)-
Insertion site3′ end of yicC
Function-
Species that IME can be transferred to-
Nucleotide SequenceBA000037.2 (complete IME sequence in this genome)
Replicon-
Genome coordinates270097..289135
Putative oriT region coordinates: 285352..285455;   oriTDB id:  200056
ATCGAGAAGCTAAACAGTGAATGGGCTAATTTCCCTGTTTGGCGTTTCGATCCAAAAGCCAAACGGATAG
TGGTTTTGGCGTATGGGGGTAAAGGCATGGGGAA
Putative relaxase -


II. IME interaction with ICE/CIME/Plasmids

The Interaction Network among ICE/IME/CIME/plasmid


Detailed Informatioin of the Interaction Network
# IME  Inter_Ele [Type] Methods Donors Recipients Exper_Ref 
1MGIVvuTai1 SXT(MO10) [ICE] experimentalin trans E. coli CAG18420 E. coli VB112 20807202

experimental This is an interactioin derived from experimental literature

Complete gene list of MGIVvuTai1 from BA000037
#GeneCoordinates [+/-], size (bp) Product *Reannotation 
1VV0254266185..267054 [+], 870ABC-type oligopeptide transport system, ATPase component
2VV0255266984..267904 [+], 921ABC-type oligopeptide transport system, ATPase component
3VV0256268030..268473 [+], 444conserved hypothetical protein
4VV0257268628..269011 [+], 384hypothetical protein
5VV0258269057..270097 [+], 1041putative membrane protein
6VV0259270073..270300 [+], 228hypothetical protein
7VV0260270370..270498 [+], 129hypothetical protein
8VV0261270633..271952 [-], 1320conserved hypothetical protein
9VV0262272326..272583 [+], 258conserved hypothetical protein
10VV0263272561..274309 [+], 1749conserved hypothetical protein
11VV0264274559..274756 [+], 198VrlI homologue
12VV0265274695..277148 [+], 2454type I site-specific restriction-modification system, R (restriction) subunit
13VV0266277154..278746 [+], 1593type I restriction-modification system methyltransferase subunit
14VV0267278743..279885 [+], 1143type I restriction-modification enzyme, specificity subunit
15VV0268279885..280682 [+], 798hypothetical protein
16VV0269280679..283921 [+], 3243hypothetical protein
17VV0270284319..285020 [-], 702hypothetical protein
18VV0271285144..285329 [-], 186hypothetical protein
19VV0272285448..285567 [+], 120hypothetical protein
20VV0273285564..286616 [+], 1053hypothetical protein
21VV0274286617..287096 [+], 480hypothetical protein
22VV0275287147..287317 [-], 171hypothetical protein
23VV0276287229..287606 [-], 378hypothetical protein
24VV0277287569..288873 [-], 1305site-specific recombinase, phage integrase familyIntegrase 
25VV0278289135..290022 [-], 888uncharacterized stress-induced protein
26VV0279290211..290927 [+], 717RNase PH
27VV0280291084..291725 [+], 642orotate phosphoribosyltransferase
28VV0281291825..292763 [-], 939lipid A biosynthesis lauroyl acyltransferase
29VV0282292767..293357 [-], 591transcriptional regulator
 
flank Flanking regions
integrase Gene may contribute to site-specific recombination

ElementNo. of sequencesDownload
Nucleotide sequences1Fasta
Proteins18Fasta
(1) Guedon G; Libante V; Coluzzi C; Payot S; Leblond-Bourget N (2017). The Obscure World of Integrative and Mobilizable Elements, Highly Widespread Elements that Pirate Bacterial Conjugative Systems. Genes (Basel). 8(11). [PudMed:29165361]
(2) Bellanger X; Payot S; Leblond-Bourget N; Guedon G (2014). Conjugative and mobilizable genomic islands in bacteria: evolution and diversity. FEMS Microbiol Rev. 38(4):720-60. [PudMed:24372381]
(3) Daccord A; Ceccarelli D; Rodrigue S; Burrus V (2013). Comparative analysis of mobilizable genomic islands. J Bacteriol. 195(3):606-14. [PudMed:23204461] experimental in_silico
(4) Daccord A; Ceccarelli D; Burrus V (2010). Integrating conjugative elements of the SXT/R391 family trigger the excision and drive the mobilization of a new class of Vibrio genomic islands. Mol Microbiol. 78(3):576-88. [PudMed:20807202] experimental
 
experimental experimental literature
in_silico in silico analysis literature