ICEberg
I. Information of IME
ICEberg ID193_IME
Name NBU1  This IME is derived from experimental literature
Family-
OrganismBacteroides uniformis
Size (bp)10276 bp
GC content [Genome] (%)-
Insertion site3′ of a tRNALeu gene
Function-
Species that IME can be transferred toBacteroides spp.; Escherichia coli
Nucleotide SequenceAF238307 (complete IME sequence in this GenBank file)
Replicon-
Coordinates1..10276
Putative oriT region coordinates: 8213..8426;   oriTDB id:  200010
TCCGCAAGGAATACAGCAGAGACCGATACATCCGTGACGCTTCACAGATTTACAGCGGATGCAAGGACTT
GAACGAATACTTACAGAAACAGGTTGAAAGAAAAAGGCAAGTCCAATCCGTCAAAGGGATGAGCAGCCAG
TCACCGAAAAAGAAAAACGGCTTTCGGTTATAGCCCACTATAACTACCTCCGCTTTCGTAGTTGTGGGCT
CTCC
Putative relaxase coordinates: 8592..9995; Gene: mobN1;  Family:  -


II. IME interaction with ICE/CIME/Plasmids

The Interaction Network among ICE/IME/CIME/plasmid


Detailed Informatioin of the Interaction Network
# IME  Inter_Ele [Type] Methods Donors Recipients Exper_Ref 
1NBU1  CTnERL [ICE] experimentalin trans Bacteroides uniformis Bacteroides thetaiotaomicron 5482; Escherichia coli 8407835; 7608064
2NBU1  CTnDOT [ICE] experimentalin trans Bacteroides uniformis Bacteroides thetaiotaomicron 5482 8407835
3NBU1  RP4 [IncP plasmid] experimentalin trans E. coli DH5αMCR E. coli HB101 8407836
4NBU1  R751 [IncP plasmid] experimentalin trans Escherichia coli Escherichia coli; Bacteroides thetaiotaomicron 8407835; 8407836

experimental This is an interactioin derived from experimental literature


The graph information of NBU1  components from AF238307
Complete gene list of NBU1  from AF238307
#GeneCoordinates [+/-], size (bp) Product *Reannotation 
1-36..755 [+], 720unknown
2-811..1254 [+], 444unknown
3-1264..2004 [+], 741unknown
4-2030..2839 [-], 810unknown
5intN13232..4569 [+], 1338IntN1Integrase 
6-4577..5518 [+], 942unknown
7-4906..5487 [-], 582unknown
8-5688..6002 [+], 315unknown
9-6007..7197 [+], 1191unknown
10prmN17429..8385 [+], 957PrmN1
11mobN18592..9995 [+], 1404MobN1Relaxase 
 
integrase Gene may contribute to site-specific recombination
conjugation Gene may play role in conjugative transfer

ElementNo. of sequencesDownload
Nucleotide sequences1Fasta
Proteins11Fasta
(1) Guedon G; Libante V; Coluzzi C; Payot S; Leblond-Bourget N (2017). The Obscure World of Integrative and Mobilizable Elements, Highly Widespread Elements that Pirate Bacterial Conjugative Systems. Genes (Basel). 8(11). [PudMed:29165361]
(2) Bellanger X; Payot S; Leblond-Bourget N; Guedon G (2014). Conjugative and mobilizable genomic islands in bacteria: evolution and diversity. FEMS Microbiol Rev. 38(4):720-60. [PudMed:24372381]
(3) Rajeev L; Malanowska K; Gardner JF (2009). Challenging a paradigm: the role of DNA homology in tyrosine recombinase reactions. Microbiol Mol Biol Rev. 73(2):300-9. [PudMed:19487729]
(4) Song B; Wang GR; Shoemaker NB; Salyers AA (2009). An unexpected effect of tetracycline concentration: growth phase-associated excision of the Bacteroides mobilizable transposon NBU1. J Bacteriol. 191(3):1078-82. [PudMed:18952794]
(5) Rajeev L; Segall A; Gardner J (2007). The bacteroides NBU1 integrase performs a homology-independent strand exchange to form a holliday junction intermediate. J Biol Chem. 282(43):31228-37. [PudMed:17766246]
(6) Rajeev L; Salyers AA; Gardner JF (2006). Characterization of the integrase of NBU1, a Bacteroides mobilizable transposon. Mol Microbiol. 61(4):978-90. [PudMed:16859497]
(7) Bass KA; Hecht DW (2002). Isolation and characterization of cLV25, a Bacteroides fragilis chromosomal transfer factor resembling multiple Bacteroides sp. mobilizable transposons. J Bacteriol. 184(7):1895-904. [PudMed:11889096]
(8) Wang J; Wang GR; Shoemaker NB; Salyers AA (2001). Production of two proteins encoded by the Bacteroides mobilizable transposon NBU1 correlates with time-dependent accumulation of the excised NBu1 circular form. J Bacteriol. 183(21):6335-43. [PudMed:11591678]
(9) Wang J; Shoemaker NB; Wang GR; Salyers AA (2000). Characterization of a Bacteroides mobilizable transposon, NBU2, which carries a functional lincomycin resistance gene. J Bacteriol. 182(12):3559-71. [PudMed:10852890]
(10) Shoemaker NB; Wang GR; Salyers AA (2000). Multiple gene products and sequences required for excision of the mobilizable integrated Bacteroides element NBU1. J Bacteriol. 182(4):928-36. [PudMed:10648516]
(11) Cooper AJ; Kalinowski AP; Shoemaker NB; Salyers AA (1997). Construction and characterization of a Bacteroides thetaiotaomicron recA mutant: transfer of Bacteroides integrated conjugative elements is RecA independent. J Bacteriol. 179(20):6221-7. [PudMed:9335266]
(12) Shoemaker NB; Wang GR; Salyers AA (1996). NBU1, a mobilizable site-specific integrated element from Bacteroides spp., can integrate nonspecifically in Escherichia coli. J Bacteriol. 178(12):3601-7. [PudMed:8655560]
(13) Shoemaker NB; Wang GR; Salyers AA (1996). The Bacteroides mobilizable insertion element, NBU1, integrates into the 3' end of a Leu-tRNA gene and has an integrase that is a member of the lambda integrase family. J Bacteriol. 178(12):3594-600. [PudMed:8655559]
(14) Li LY; Shoemaker NB; Salyers AA (1993). Characterization of the mobilization region of a Bacteroides insertion element (NBU1) that is excised and transferred by Bacteroides conjugative transposons. J Bacteriol. 175(20):6588-98. [PudMed:8407836]
(15) Shoemaker NB; Wang GR; Stevens AM; Salyers AA (1993). Excision, transfer, and integration of NBU1, a mobilizable site-selective insertion element. J Bacteriol. 175(20):6578-87. [PudMed:8407835]
(16) Shoemaker NB; Li LY; Salyers AA (1994). An unusual type of cointegrate formation between a Bacteroides plasmid and the excised circular form of an integrated element (NBU1). Plasmid. 32(3):312-7. [PudMed:7899516]
(17) Li LY; Shoemaker NB; Wang GR; Cole SP; Hashimoto MK; Wang J; Salyers AA (1995). The mobilization regions of two integrated Bacteroides elements, NBU1 and NBU2, have only a single mobilization protein and may be on a cassette. J Bacteriol. 177(14):3940-5. [PudMed:7608064]
(18) Shoemaker NB; Salyers AA (1988). Tetracycline-dependent appearance of plasmidlike forms in Bacteroides uniformis 0061 mediated by conjugal Bacteroides tetracycline resistance elements. J Bacteriol. 170(4):1651-7. [PudMed:2832373]
(19) Stevens AM; Shoemaker NB; Salyers AA (1990). The region of a Bacteroides conjugal chromosomal tetracycline resistance element which is responsible for production of plasmidlike forms from unlinked chromosomal DNA might also be involved in transfer of the element. J Bacteriol. 172(8):4271-9. [PudMed:2165473]