SecReT6
Protein ID: 110671183
SecReT6 ID469
T6SS typeii
Gene symbol-
Locus tagFTF1702
StrainFrancisella tularensis subsp. tularensis FSC198
Repliconchromosome [GenBank: NC_008245] [Browse all T6SS(s) in this replicon]
Location [Strand]1779229..1779723 [+]
Producthypothetical protein
NoteVgrG
UniProt IDQ14FT8
KEGG IDftf:FTF1347, ftf:FTF1702
PDB IDNA
Domain hit(s) vs Pfam DUF2345 [PF10106], Evalue: 0.0056, Aligned region: 28..73
DUF2345 [PF10106], Evalue: 0.0056, Aligned region: 71..105
DUF2345 [PF10106], Evalue: 0.0056, Aligned region: 107..150
Protein Sequence: 164 a.a.     [Download]
>gi|110671183|ref|YP_667740.1| hypothetical protein FTF1702 [Francisella tularensis subsp. tularensis FSC198]
MSKADHIFNLEEQGLLIDIKDDSKGCTTKLESSGKITHNATESIESSADKQIIENVKDSKISITEKEILL
ATKKSSIMLSEDKIVIKIGNSLIILDDSNISLESATINIKSSANINIQASQNIDIKSLNNSIKADVNLNA
EGLDVNIKGSVTASIKGSTATMVG
 
Nucleotide Sequence: 495 bp     [Download]
>gi|110669657|ref|NC_008245.1|:1779229-1779723 Francisella tularensis subsp. tularensis FSC198 chromosome, complete genome
ATGTCAAAAGCAGACCATATTTTCAACTTAGAAGAGCAAGGCTTGCTCATAGATATCAAAGATGATTCAA
AAGGCTGCACTACGAAACTAGAGTCCTCTGGAAAAATCACTCATAATGCAACTGAATCGATAGAGTCAAG
CGCTGATAAACAAATAATTGAAAATGTCAAAGACTCAAAAATATCAATAACTGAAAAAGAAATTTTGTTA
GCTACTAAGAAATCAAGCATTATGCTTAGTGAAGATAAAATTGTCATAAAAATAGGTAATTCTTTAATTA
TACTTGATGATTCAAATATTTCGCTAGAGTCTGCAACTATTAATATAAAAAGCTCTGCTAATATAAATAT
TCAAGCATCACAGAACATAGATATAAAAAGTCTAAATAATAGTATCAAAGCAGATGTAAACCTTAATGCT
GAAGGGTTAGATGTAAATATTAAAGGAAGTGTAACAGCAAGCATAAAAGGTTCTACAGCAACAATGGTTG
GATAA